Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2121689..2121834 | Replicon | chromosome |
Accession | NZ_CP064672 | ||
Organism | Salmonella sp. SJTUF14146 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2121729..2121832 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2121689..2121834 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
IVP14_RS10315 | 2118115..2118813 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
IVP14_RS10320 | 2118837..2119493 | - | 657 | WP_023227121.1 | carbon-nitrogen hydrolase family protein | - |
IVP14_RS10325 | 2119601..2119831 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
IVP14_RS10330 | 2119969..2120343 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
IVP14_RS10335 | 2120344..2121219 | + | 876 | WP_001579467.1 | copper homeostasis membrane protein CopD | - |
IVP14_RS10340 | 2121236..2121589 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 2121689..2121834 | - | 146 | - | - | Antitoxin |
- | 2121729..2121832 | + | 104 | - | - | Toxin |
IVP14_RS10345 | 2121953..2122603 | - | 651 | Protein_2023 | tyrosine-type recombinase/integrase | - |
IVP14_RS10350 | 2122858..2123843 | + | 986 | Protein_2024 | DUF1353 domain-containing protein | - |
IVP14_RS10355 | 2123892..2124001 | + | 110 | Protein_2025 | tail fiber assembly protein | - |
IVP14_RS10360 | 2124092..2124277 | - | 186 | WP_071787785.1 | hypothetical protein | - |
IVP14_RS10365 | 2124713..2125483 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
IVP14_RS10370 | 2125964..2126101 | + | 138 | Protein_2028 | helix-turn-helix domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 2116029..2150534 | 34505 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T181374 NZ_CP064672:2121729-2121832 [Salmonella sp. SJTUF14146]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT181374 NZ_CP064672:c2121834-2121689 [Salmonella sp. SJTUF14146]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG