Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2167659..2167804 | Replicon | chromosome |
Accession | NZ_CP064671 | ||
Organism | Salmonella sp. SJTUF14152 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2167699..2167802 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2167659..2167804 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
IVP15_RS10530 | 2164085..2164783 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
IVP15_RS10535 | 2164807..2165463 | - | 657 | Protein_2061 | carbon-nitrogen hydrolase family protein | - |
IVP15_RS10540 | 2165571..2165801 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
IVP15_RS10545 | 2165939..2166313 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
IVP15_RS10550 | 2166314..2167189 | + | 876 | WP_001579467.1 | copper homeostasis membrane protein CopD | - |
IVP15_RS10555 | 2167206..2167559 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 2167659..2167804 | - | 146 | - | - | Antitoxin |
- | 2167699..2167802 | + | 104 | - | - | Toxin |
IVP15_RS10560 | 2167923..2168573 | - | 651 | Protein_2066 | tyrosine-type recombinase/integrase | - |
IVP15_RS10565 | 2168828..2169813 | + | 986 | Protein_2067 | DUF1353 domain-containing protein | - |
IVP15_RS10570 | 2169862..2169971 | + | 110 | Protein_2068 | tail fiber assembly protein | - |
IVP15_RS10575 | 2170062..2170247 | - | 186 | WP_071787785.1 | hypothetical protein | - |
IVP15_RS10580 | 2170683..2171453 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
IVP15_RS10585 | 2171934..2172071 | + | 138 | Protein_2071 | helix-turn-helix domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 2145791..2196504 | 50713 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T181354 NZ_CP064671:2167699-2167802 [Salmonella sp. SJTUF14152]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT181354 NZ_CP064671:c2167804-2167659 [Salmonella sp. SJTUF14152]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG