Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2102645..2102790 | Replicon | chromosome |
Accession | NZ_CP064663 | ||
Organism | Salmonella sp. SJTUF14170 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2102685..2102788 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2102645..2102790 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
IVP17_RS10170 | 2099071..2099769 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
IVP17_RS10175 | 2099793..2100449 | - | 657 | WP_023227121.1 | carbon-nitrogen hydrolase family protein | - |
IVP17_RS10180 | 2100557..2100787 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
IVP17_RS10185 | 2100925..2101299 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
IVP17_RS10190 | 2101300..2102175 | + | 876 | WP_001579467.1 | copper homeostasis membrane protein CopD | - |
IVP17_RS10195 | 2102192..2102545 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 2102645..2102790 | - | 146 | - | - | Antitoxin |
- | 2102685..2102788 | + | 104 | - | - | Toxin |
IVP17_RS10200 | 2102909..2103559 | - | 651 | Protein_1993 | tyrosine-type recombinase/integrase | - |
IVP17_RS10205 | 2103814..2104799 | + | 986 | Protein_1994 | DUF1353 domain-containing protein | - |
IVP17_RS10210 | 2104848..2104957 | + | 110 | Protein_1995 | tail fiber assembly protein | - |
IVP17_RS10215 | 2105048..2105233 | - | 186 | WP_071787785.1 | hypothetical protein | - |
IVP17_RS10220 | 2105669..2106439 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
IVP17_RS10225 | 2106920..2107057 | + | 138 | Protein_1998 | helix-turn-helix domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2096985..2104899 | 7914 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T181313 NZ_CP064663:2102685-2102788 [Salmonella sp. SJTUF14170]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT181313 NZ_CP064663:c2102790-2102645 [Salmonella sp. SJTUF14170]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG