Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 761211..761356 | Replicon | chromosome |
Accession | NZ_CP064352 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae ATCC 43816 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 761247..761349 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 761211..761356 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
IT767_RS03515 | 756341..758401 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
IT767_RS03520 | 758405..759064 | - | 660 | WP_038431281.1 | exodeoxyribonuclease X | - |
IT767_RS03525 | 759143..759373 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
IT767_RS03530 | 759486..759860 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
IT767_RS03535 | 759864..760733 | + | 870 | WP_004891049.1 | copper homeostasis membrane protein CopD | - |
IT767_RS03540 | 760750..761088 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 761211..761356 | - | 146 | - | - | Antitoxin |
- | 761247..761349 | + | 103 | - | - | Toxin |
IT767_RS03545 | 761725..761868 | - | 144 | WP_038431282.1 | Ecr family regulatory small membrane protein | - |
IT767_RS03550 | 761973..762941 | - | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
IT767_RS03555 | 763098..763751 | + | 654 | WP_023280291.1 | protein-serine/threonine phosphatase | - |
IT767_RS03560 | 763748..763939 | - | 192 | WP_002911395.1 | YebW family protein | - |
IT767_RS03565 | 764037..764276 | - | 240 | WP_002911393.1 | YebV family protein | - |
IT767_RS03570 | 764392..765825 | - | 1434 | WP_032415191.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T180884 NZ_CP064352:761247-761349 [Klebsiella pneumoniae subsp. pneumoniae ATCC 43816]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT180884 NZ_CP064352:c761356-761211 [Klebsiella pneumoniae subsp. pneumoniae ATCC 43816]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT