Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2576738..2576832 | Replicon | chromosome |
| Accession | NZ_CP064118 | ||
| Organism | Yersinia pestis strain C-783 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2576739..2576832 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2576738..2576832 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ISU55_RS11805 | 2571931..2574009 | - | 2079 | WP_002211100.1 | flagellar biosynthesis protein FlhA | - |
| ISU55_RS11810 | 2574009..2575169 | - | 1161 | WP_002211099.1 | flagellar type III secretion system protein FlhB | - |
| ISU55_RS11815 | 2575701..2576159 | + | 459 | WP_002211098.1 | hypothetical protein | - |
| ISU55_RS11820 | 2576153..2576479 | + | 327 | WP_002211097.1 | DUF1493 family protein | - |
| - | 2576738..2576832 | + | 95 | - | - | Antitoxin |
| - | 2576739..2576832 | - | 94 | - | - | Toxin |
| ISU55_RS11825 | 2577002..2577343 | - | 342 | WP_002211095.1 | YebY family protein | - |
| ISU55_RS11830 | 2577440..2578324 | - | 885 | WP_002211094.1 | copper homeostasis membrane protein CopD | - |
| ISU55_RS11835 | 2578327..2578713 | - | 387 | WP_002211093.1 | CopC domain-containing protein YobA | - |
| ISU55_RS11840 | 2579119..2579628 | - | 510 | WP_002211092.1 | non-heme ferritin | - |
| ISU55_RS11845 | 2580029..2580259 | + | 231 | WP_140270001.1 | DNA polymerase III subunit theta | - |
| ISU55_RS11850 | 2580319..2581269 | - | 951 | WP_002211090.1 | prolyl aminopeptidase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | fliZ / fliA / fliD / fliS / fliT / fliE / fliF / fliG / fliH / fliI / fliJ / fliL / fliM / fliN / fliP / fliQ / fliR / flgL / flgK / flgJ / flgI / flgH / flgG / flgF / flgE / flgD / flgC / flgB / flgA / flgM / flgN / flhE / flhA / flhB | 2458561..2580259 | 121698 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 94 bp
>T180210 NZ_CP064118:c2576832-2576739 [Yersinia pestis]
TAAGCCTACATTAATACCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATCAGGAATCGTA
TTCGGTCTTTTTTT
TAAGCCTACATTAATACCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATCAGGAATCGTA
TTCGGTCTTTTTTT
Antitoxin
Download Length: 95 bp
>AT180210 NZ_CP064118:2576738-2576832 [Yersinia pestis]
TAAAAAAAGACCGAATACGATTCCTGATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGT
ATTAATGTAGGCTTA
TAAAAAAAGACCGAATACGATTCCTGATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGT
ATTAATGTAGGCTTA
