Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 4599444..4599591 | Replicon | chromosome |
Accession | NZ_CP063874 | ||
Organism | Klebsiella quasipneumoniae strain S174-1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 4599485..4599587 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 4599444..4599591 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
IOD26_RS22405 | 4594579..4596639 | + | 2061 | WP_004203388.1 | oligopeptidase B | - |
IOD26_RS22410 | 4596643..4597302 | - | 660 | WP_004203387.1 | exodeoxyribonuclease X | - |
IOD26_RS22415 | 4597381..4597611 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
IOD26_RS22420 | 4597724..4598098 | + | 375 | WP_065877427.1 | CopC domain-containing protein YobA | - |
IOD26_RS22425 | 4598102..4598971 | + | 870 | WP_200982571.1 | copper homeostasis membrane protein CopD | - |
IOD26_RS22430 | 4598988..4599326 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 4599444..4599591 | - | 148 | - | - | Antitoxin |
- | 4599485..4599587 | + | 103 | - | - | Toxin |
IOD26_RS22435 | 4599975..4600118 | - | 144 | WP_032425946.1 | Ecr family regulatory small membrane protein | - |
IOD26_RS22440 | 4600222..4601190 | - | 969 | WP_151628733.1 | VirK/YbjX family protein | - |
IOD26_RS22445 | 4601347..4602000 | + | 654 | WP_064149723.1 | protein-serine/threonine phosphatase | - |
IOD26_RS22450 | 4601997..4602188 | - | 192 | WP_002911395.1 | YebW family protein | - |
IOD26_RS22455 | 4602286..4602525 | - | 240 | WP_002911393.1 | YebV family protein | - |
IOD26_RS22460 | 4602642..4604075 | - | 1434 | WP_032456308.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 4585693..4609494 | 23801 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T179125 NZ_CP063874:4599485-4599587 [Klebsiella quasipneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 148 bp
>AT179125 NZ_CP063874:c4599591-4599444 [Klebsiella quasipneumoniae]
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG