Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1980907..1981055 | Replicon | chromosome |
Accession | NZ_CP063427 | ||
Organism | Citrobacter sp. BDA59-3 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1980953..1981055 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1980907..1981055 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
IP582_RS09260 | 1976096..1978156 | + | 2061 | WP_193795727.1 | oligopeptidase B | - |
IP582_RS09265 | 1978153..1978830 | - | 678 | WP_193795728.1 | exodeoxyribonuclease X | - |
IP582_RS09270 | 1978827..1979057 | - | 231 | WP_039078743.1 | DNA polymerase III subunit theta | - |
IP582_RS09275 | 1979195..1979569 | + | 375 | WP_039078744.1 | CopC domain-containing protein YobA | - |
IP582_RS09280 | 1979571..1980440 | + | 870 | WP_193795729.1 | copper homeostasis membrane protein CopD | - |
IP582_RS09285 | 1980455..1980796 | + | 342 | WP_107222991.1 | YebY family protein | - |
- | 1980907..1981055 | - | 149 | - | - | Antitoxin |
- | 1980953..1981055 | + | 103 | - | - | Toxin |
IP582_RS09290 | 1981142..1982248 | - | 1107 | WP_193795730.1 | phage integrase Arm DNA-binding domain-containing protein | - |
IP582_RS09295 | 1982223..1982495 | - | 273 | WP_107222989.1 | excisionase | - |
IP582_RS09300 | 1982560..1983120 | - | 561 | WP_193796219.1 | 3'-5' exoribonuclease | - |
IP582_RS09305 | 1983175..1983453 | + | 279 | WP_193795731.1 | host cell division inhibitor Icd-like protein | - |
IP582_RS09310 | 1983446..1983700 | + | 255 | WP_108700605.1 | hypothetical protein | - |
IP582_RS09315 | 1983697..1984064 | + | 368 | Protein_1802 | hypothetical protein | - |
IP582_RS09320 | 1984061..1985431 | + | 1371 | WP_193795732.1 | helicase RepA family protein | - |
IP582_RS09325 | 1985612..1985974 | + | 363 | WP_193795733.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1959991..2021925 | 61934 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T178217 NZ_CP063427:1980953-1981055 [Citrobacter sp. BDA59-3]
GCATGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTTTTTTT
GCATGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTTTTTTT
Antitoxin
Download Length: 149 bp
>AT178217 NZ_CP063427:c1981055-1980907 [Citrobacter sp. BDA59-3]
AAAAAAAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TAATGCAGGCTAAGTCGCCATGCACTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCGGCAAA
AAAAAAAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TAATGCAGGCTAAGTCGCCATGCACTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCGGCAAA