Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2141343..2141483 | Replicon | chromosome |
Accession | NZ_CP063238 | ||
Organism | Serratia marcescens strain SCH909 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2141387..2141483 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2141343..2141483 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
SCH909_RS10250 | 2136544..2136969 | + | 426 | WP_033653830.1 | RNA polymerase-binding protein DksA | - |
SCH909_RS10255 | 2137163..2138116 | + | 954 | WP_060446493.1 | prolyl aminopeptidase | - |
SCH909_RS10260 | 2138148..2138378 | - | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
SCH909_RS10265 | 2138724..2139236 | + | 513 | WP_060420626.1 | non-heme ferritin | - |
SCH909_RS10270 | 2139567..2139950 | + | 384 | WP_004940886.1 | CopC domain-containing protein YobA | - |
SCH909_RS10275 | 2139953..2140834 | + | 882 | WP_047568032.1 | copper homeostasis membrane protein CopD | - |
SCH909_RS10280 | 2140904..2141245 | + | 342 | WP_025302452.1 | YebY family protein | - |
- | 2141343..2141483 | - | 141 | - | - | Antitoxin |
- | 2141387..2141483 | + | 97 | - | - | Toxin |
SCH909_RS10285 | 2141725..2142129 | + | 405 | WP_047568029.1 | hypothetical protein | - |
SCH909_RS10290 | 2142126..2142344 | - | 219 | WP_033638114.1 | hypothetical protein | - |
SCH909_RS10295 | 2142408..2142572 | - | 165 | WP_154609290.1 | hypothetical protein | - |
SCH909_RS10300 | 2142865..2143215 | + | 351 | WP_033638116.1 | DUF4377 domain-containing protein | - |
SCH909_RS10305 | 2143399..2144598 | + | 1200 | WP_200761793.1 | trans-2-enoyl-CoA reductase family protein | - |
SCH909_RS10310 | 2144826..2145044 | + | 219 | WP_033646423.1 | hypothetical protein | - |
SCH909_RS10315 | 2145216..2145521 | + | 306 | WP_033646422.1 | hypothetical protein | - |
SCH909_RS10320 | 2145565..2145900 | + | 336 | WP_033653833.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T177801 NZ_CP063238:2141387-2141483 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT177801 NZ_CP063238:c2141483-2141343 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG