Detailed information of TA system
Overview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2677825..2678096 | Replicon | chromosome |
Accession | NZ_CP062211 | ||
Organism | Escherichia coli strain L3Cip3 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2677863..2677966 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2677825..2678096 (+) |
Genomic Context
Location: 2674982..2676421 (1440 bp)
Type: Others
Protein ID: WP_024190454.1
Type: Others
Protein ID: WP_024190454.1
Location: 2676539..2676775 (237 bp)
Type: Others
Protein ID: WP_001295499.1
Type: Others
Protein ID: WP_001295499.1
Location: 2676880..2677071 (192 bp)
Type: Others
Protein ID: WP_001296140.1
Type: Others
Protein ID: WP_001296140.1
Location: 2677825..2678096 (272 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 2679867..2680097 (231 bp)
Type: Others
Protein ID: WP_000916763.1
Type: Others
Protein ID: WP_000916763.1
Location: 2680199..2680855 (657 bp)
Type: Others
Protein ID: WP_000011652.1
Type: Others
Protein ID: WP_000011652.1
Location: 2680879..2681541 (663 bp)
Type: Others
Protein ID: WP_000944256.1
Type: Others
Protein ID: WP_000944256.1
Location: 2677072..2677728 (657 bp)
Type: Others
Protein ID: WP_000812734.1
Type: Others
Protein ID: WP_000812734.1
Location: 2677863..2677966 (104 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 2678124..2678465 (342 bp)
Type: Others
Protein ID: WP_000976492.1
Type: Others
Protein ID: WP_000976492.1
Location: 2678478..2679350 (873 bp)
Type: Others
Protein ID: WP_000879285.1
Type: Others
Protein ID: WP_000879285.1
Location: 2679354..2679728 (375 bp)
Type: Others
Protein ID: WP_000204699.1
Type: Others
Protein ID: WP_000204699.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
IFO96_RS12955 | 2674982..2676421 | + | 1440 | WP_024190454.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
IFO96_RS12960 | 2676539..2676775 | + | 237 | WP_001295499.1 | DUF1480 family protein | - |
IFO96_RS12965 | 2676880..2677071 | + | 192 | WP_001296140.1 | YebW family protein | - |
IFO96_RS12970 | 2677072..2677728 | - | 657 | WP_000812734.1 | protein-serine/threonine phosphatase | - |
- | 2677825..2678096 | + | 272 | - | - | Antitoxin |
- | 2677863..2677966 | - | 104 | - | - | Toxin |
IFO96_RS12975 | 2678124..2678465 | - | 342 | WP_000976492.1 | YebY family protein | - |
IFO96_RS12980 | 2678478..2679350 | - | 873 | WP_000879285.1 | copper homeostasis membrane protein CopD | - |
IFO96_RS12985 | 2679354..2679728 | - | 375 | WP_000204699.1 | CopC domain-containing protein YobA | - |
IFO96_RS12990 | 2679867..2680097 | + | 231 | WP_000916763.1 | DNA polymerase III subunit theta | - |
IFO96_RS12995 | 2680199..2680855 | + | 657 | WP_000011652.1 | carbon-nitrogen hydrolase family protein | - |
IFO96_RS13000 | 2680879..2681541 | + | 663 | WP_000944256.1 | exodeoxyribonuclease X | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
No matching records found |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T173540 NZ_CP062211:c2677966-2677863 [Escherichia coli]
GGCAAGGCAACTAAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTGTTCGGTCTCTTTTT
GGCAAGGCAACTAAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTGTTCGGTCTCTTTTT
Antitoxin
Download Length: 272 bp
>AT173540 NZ_CP062211:2677825-2678096 [Escherichia coli]
AAAGTCAGCGAAGGAAATGCTTCTGGCTTTTAACAGATAAAAAGAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAA
TGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCATTAATGCAGGCTTAGTTGCCTTGCCCTTTAAGAATAGATGACG
ACGCCAGGTTTTCCAGTTTGCGTGCAAAATGGTCAATAAAAAGCGTGGTGGTCATCAGCTGAAATGTTAAAAACCGCCCG
TTCTGGTGAAAGAACTGAGGCGGTTTTTTTAT
AAAGTCAGCGAAGGAAATGCTTCTGGCTTTTAACAGATAAAAAGAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAA
TGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCATTAATGCAGGCTTAGTTGCCTTGCCCTTTAAGAATAGATGACG
ACGCCAGGTTTTCCAGTTTGCGTGCAAAATGGTCAATAAAAAGCGTGGTGGTCATCAGCTGAAATGTTAAAAACCGCCCG
TTCTGGTGAAAGAACTGAGGCGGTTTTTTTAT