Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1844734..1844879 | Replicon | chromosome |
Accession | NZ_CP062138 | ||
Organism | Klebsiella quasipneumoniae strain 203 19001 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1844770..1844872 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1844734..1844879 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
IG177_RS08995 | 1839864..1841924 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
IG177_RS09000 | 1841928..1842587 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
IG177_RS09005 | 1842666..1842896 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
IG177_RS09010 | 1843009..1843383 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
IG177_RS09015 | 1843387..1844256 | + | 870 | WP_023316211.1 | copper homeostasis membrane protein CopD | - |
IG177_RS09020 | 1844273..1844611 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1844734..1844879 | - | 146 | - | - | Antitoxin |
- | 1844770..1844872 | + | 103 | - | - | Toxin |
IG177_RS09025 | 1845247..1845390 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
IG177_RS09030 | 1845495..1846463 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
IG177_RS09035 | 1846620..1847273 | + | 654 | WP_019725444.1 | protein-serine/threonine phosphatase | - |
IG177_RS09040 | 1847270..1847461 | - | 192 | WP_002911395.1 | YebW family protein | - |
IG177_RS09045 | 1847559..1847798 | - | 240 | WP_002911393.1 | YebV family protein | - |
IG177_RS09050 | 1847914..1849347 | - | 1434 | WP_192242835.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T173396 NZ_CP062138:1844770-1844872 [Klebsiella quasipneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT173396 NZ_CP062138:c1844879-1844734 [Klebsiella quasipneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT