Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2116542..2116665 | Replicon | chromosome |
Accession | NZ_CP061082 | ||
Organism | Serratia liquefaciens strain MT49 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2116564..2116660 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2116542..2116665 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
IAI46_RS09985 | 2111724..2112149 | + | 426 | WP_020826374.1 | RNA polymerase-binding protein DksA | - |
IAI46_RS09990 | 2112322..2113275 | + | 954 | WP_187962712.1 | prolyl aminopeptidase | - |
IAI46_RS09995 | 2113306..2113536 | - | 231 | WP_020826376.1 | DNA polymerase III subunit theta | - |
IAI46_RS10000 | 2113909..2114427 | + | 519 | WP_020826377.1 | non-heme ferritin | - |
IAI46_RS10005 | 2114743..2115126 | + | 384 | WP_020826378.1 | CopC domain-containing protein YobA | - |
IAI46_RS10010 | 2115130..2116011 | + | 882 | WP_187962713.1 | copper homeostasis membrane protein CopD | - |
IAI46_RS10015 | 2116081..2116422 | + | 342 | WP_020826380.1 | YebY family protein | - |
- | 2116542..2116665 | - | 124 | - | - | Antitoxin |
- | 2116564..2116660 | + | 97 | - | - | Toxin |
IAI46_RS10020 | 2116922..2117488 | - | 567 | WP_122078618.1 | DUF4136 domain-containing protein | - |
IAI46_RS10025 | 2117764..2118114 | + | 351 | WP_187962714.1 | DUF4377 domain-containing protein | - |
IAI46_RS10030 | 2118158..2119006 | - | 849 | WP_187962963.1 | aminoglycoside phosphotransferase family protein | - |
IAI46_RS10035 | 2119218..2120417 | + | 1200 | WP_020826387.1 | trans-2-enoyl-CoA reductase family protein | - |
IAI46_RS10040 | 2120560..2121123 | + | 564 | WP_048760583.1 | DUF2975 domain-containing protein | - |
IAI46_RS10045 | 2121131..2121346 | + | 216 | WP_041415317.1 | helix-turn-helix transcriptional regulator | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T172056 NZ_CP061082:2116564-2116660 [Serratia liquefaciens]
AACAAGCCTTGCACAAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCTTGCACAAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 124 bp
>AT172056 NZ_CP061082:c2116665-2116542 [Serratia liquefaciens]
AACACAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTTTGTGCAAGGCTTGTTCAGCCATGCACTTTAAGAGTAG
AACACAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTTTGTGCAAGGCTTGTTCAGCCATGCACTTTAAGAGTAG