Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2034152..2034295 | Replicon | chromosome |
| Accession | NZ_CP060852 | ||
| Organism | Salmonella enterica strain 467 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2034190..2034293 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2034152..2034295 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| IAR30_RS09700 | 2030576..2031274 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| IAR30_RS09705 | 2031298..2031954 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| IAR30_RS09710 | 2032062..2032292 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| IAR30_RS09715 | 2032430..2032804 | + | 375 | WP_000168396.1 | CopC domain-containing protein YobA | - |
| IAR30_RS09720 | 2032805..2033680 | + | 876 | WP_000979699.1 | copper homeostasis membrane protein CopD | - |
| IAR30_RS09725 | 2033697..2034050 | + | 354 | WP_126524015.1 | YebY family protein | - |
| - | 2034152..2034295 | - | 144 | - | - | Antitoxin |
| - | 2034190..2034293 | + | 104 | - | - | Toxin |
| IAR30_RS09730 | 2034424..2035074 | - | 651 | Protein_1903 | tyrosine-type recombinase/integrase | - |
| IAR30_RS09735 | 2035085..2035390 | + | 306 | WP_206519696.1 | hypothetical protein | - |
| IAR30_RS09740 | 2035347..2035550 | + | 204 | Protein_1905 | phage tail protein | - |
| IAR30_RS09745 | 2035722..2035877 | + | 156 | Protein_1906 | phage tail protein | - |
| IAR30_RS09750 | 2035983..2036315 | + | 333 | WP_061383450.1 | DUF1353 domain-containing protein | - |
| IAR30_RS09755 | 2036364..2036473 | + | 110 | Protein_1908 | tail fiber assembly protein | - |
| IAR30_RS09760 | 2036564..2036749 | - | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| IAR30_RS09765 | 2037001..2037189 | - | 189 | Protein_1910 | tail fiber assembly protein | - |
| IAR30_RS09770 | 2037185..2037955 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| IAR30_RS09780 | 2038446..2038574 | + | 129 | Protein_1912 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2026811..2078308 | 51497 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T171180 NZ_CP060852:2034190-2034293 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT171180 NZ_CP060852:c2034295-2034152 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
