Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 3584587..3584730 | Replicon | chromosome |
| Accession | NZ_CP060844 | ||
| Organism | Salmonella enterica strain 770 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 3584589..3584692 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 3584587..3584730 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| IAR33_RS17135 | 3580308..3580436 | - | 129 | Protein_3339 | helix-turn-helix domain-containing protein | - |
| IAR33_RS17145 | 3580927..3581697 | + | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| IAR33_RS17150 | 3581693..3581881 | + | 189 | Protein_3341 | tail fiber assembly protein | - |
| IAR33_RS17155 | 3582133..3582318 | + | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| IAR33_RS17160 | 3582409..3582518 | - | 110 | Protein_3343 | tail fiber assembly protein | - |
| IAR33_RS17165 | 3582567..3582899 | - | 333 | WP_061383450.1 | DUF1353 domain-containing protein | - |
| IAR33_RS17170 | 3583005..3583160 | - | 156 | Protein_3345 | phage tail protein | - |
| IAR33_RS17175 | 3583332..3583535 | - | 204 | Protein_3346 | phage tail protein | - |
| IAR33_RS17180 | 3583492..3583797 | - | 306 | WP_206519696.1 | hypothetical protein | - |
| IAR33_RS17185 | 3583808..3584458 | + | 651 | Protein_3348 | tyrosine-type recombinase/integrase | - |
| - | 3584587..3584730 | + | 144 | - | - | Antitoxin |
| - | 3584589..3584692 | - | 104 | - | - | Toxin |
| IAR33_RS17190 | 3584832..3585185 | - | 354 | WP_126524015.1 | YebY family protein | - |
| IAR33_RS17195 | 3585202..3586077 | - | 876 | WP_000979699.1 | copper homeostasis membrane protein CopD | - |
| IAR33_RS17200 | 3586078..3586452 | - | 375 | WP_000168396.1 | CopC domain-containing protein YobA | - |
| IAR33_RS17205 | 3586590..3586820 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| IAR33_RS17210 | 3586928..3587584 | + | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| IAR33_RS17215 | 3587608..3588306 | + | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 3577351..3606602 | 29251 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T171130 NZ_CP060844:c3584692-3584589 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT171130 NZ_CP060844:3584587-3584730 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
