Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2002631..2002774 | Replicon | chromosome |
| Accession | NZ_CP060834 | ||
| Organism | Salmonella enterica strain 1505 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2002669..2002772 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2002631..2002774 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| IAR36_RS09570 | 1999055..1999753 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| IAR36_RS09575 | 1999777..2000433 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| IAR36_RS09580 | 2000541..2000771 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| IAR36_RS09585 | 2000909..2001283 | + | 375 | WP_000168396.1 | CopC domain-containing protein YobA | - |
| IAR36_RS09590 | 2001284..2002159 | + | 876 | WP_000979699.1 | copper homeostasis membrane protein CopD | - |
| IAR36_RS09595 | 2002176..2002529 | + | 354 | WP_126524015.1 | YebY family protein | - |
| - | 2002631..2002774 | - | 144 | - | - | Antitoxin |
| - | 2002669..2002772 | + | 104 | - | - | Toxin |
| IAR36_RS09600 | 2002903..2003553 | - | 651 | Protein_1877 | tyrosine-type recombinase/integrase | - |
| IAR36_RS09605 | 2003564..2003869 | + | 306 | WP_206519696.1 | hypothetical protein | - |
| IAR36_RS09610 | 2003826..2004029 | + | 204 | Protein_1879 | phage tail protein | - |
| IAR36_RS09615 | 2004201..2004356 | + | 156 | Protein_1880 | phage tail protein | - |
| IAR36_RS09620 | 2004462..2004794 | + | 333 | WP_061383450.1 | DUF1353 domain-containing protein | - |
| IAR36_RS09625 | 2004843..2004952 | + | 110 | Protein_1882 | tail fiber assembly protein | - |
| IAR36_RS09630 | 2005043..2005228 | - | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| IAR36_RS09635 | 2005480..2005668 | - | 189 | Protein_1884 | tail fiber assembly protein | - |
| IAR36_RS09640 | 2005664..2006434 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| IAR36_RS09650 | 2006925..2007053 | + | 129 | Protein_1886 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 1996967..2014071 | 17104 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T171067 NZ_CP060834:2002669-2002772 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT171067 NZ_CP060834:c2002774-2002631 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG