Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2334588..2334733 | Replicon | chromosome |
Accession | NZ_CP060666 | ||
Organism | Salmonella enterica strain 190821_1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2334590..2334693 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2334588..2334733 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
H9Q88_RS11615 | 2329788..2330006 | - | 219 | WP_001524708.1 | hypothetical protein | - |
H9Q88_RS11620 | 2330308..2330406 | - | 99 | WP_223151200.1 | hypothetical protein | - |
H9Q88_RS11625 | 2330725..2332704 | - | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
H9Q88_RS11630 | 2333118..2333396 | + | 279 | WP_001575998.1 | excisionase | - |
H9Q88_RS11635 | 2333371..2334450 | + | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2334588..2334733 | + | 146 | - | - | Antitoxin |
- | 2334590..2334693 | - | 104 | - | - | Toxin |
H9Q88_RS11640 | 2334833..2335186 | - | 354 | WP_000722370.1 | YebY family protein | - |
H9Q88_RS11645 | 2335203..2336078 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
H9Q88_RS11650 | 2336079..2336453 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
H9Q88_RS11655 | 2336591..2336821 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
H9Q88_RS11660 | 2336929..2337585 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
H9Q88_RS11665 | 2337609..2338307 | + | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 / sopE2 / sodCI | 2280689..2356603 | 75914 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T170543 NZ_CP060666:c2334693-2334590 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT170543 NZ_CP060666:2334588-2334733 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG