Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3390952..3391041 | Replicon | chromosome |
Accession | NZ_CP060592 | ||
Organism | Rouxiella badensis strain C173 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3390952..3391041 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3390952..3391041 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
H2866_RS15605 | 3386712..3387665 | + | 954 | WP_192503519.1 | prolyl aminopeptidase | - |
H2866_RS15610 | 3387703..3387933 | - | 231 | WP_084912439.1 | DNA polymerase III subunit theta | - |
H2866_RS15615 | 3388338..3388844 | + | 507 | WP_017493797.1 | non-heme ferritin | - |
H2866_RS15620 | 3389073..3389456 | + | 384 | WP_017493798.1 | copper homeostasis periplasmic binding protein CopC | - |
H2866_RS15625 | 3389461..3390345 | + | 885 | WP_192503520.1 | copper homeostasis membrane protein CopD | - |
H2866_RS15630 | 3390406..3390741 | + | 336 | WP_017493800.1 | YebY family protein | - |
- | 3390952..3391041 | + | 90 | - | - | Toxin |
H2866_RS15635 | 3391098..3391304 | - | 207 | WP_192504458.1 | integrase | - |
H2866_RS15640 | 3391600..3391800 | + | 201 | WP_192503521.1 | DUF1203 domain-containing protein | - |
H2866_RS15645 | 3391856..3392053 | - | 198 | WP_192503522.1 | DUF1737 domain-containing protein | - |
H2866_RS15650 | 3392043..3392318 | - | 276 | WP_084912825.1 | hypothetical protein | - |
H2866_RS15655 | 3392641..3392868 | + | 228 | Protein_3028 | transposase | - |
H2866_RS15660 | 3392877..3393209 | + | 333 | WP_192503523.1 | integrase core domain-containing protein | - |
H2866_RS15665 | 3393933..3394349 | + | 417 | WP_017493707.1 | NUDIX hydrolase | - |
H2866_RS15670 | 3394437..3394685 | - | 249 | WP_017493706.1 | hypothetical protein | - |
H2866_RS15675 | 3395205..3395474 | + | 270 | WP_017493705.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 3380847..3394349 | 13502 | |
- | flank | IS/Tn | - | - | 3392641..3392916 | 275 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 90 bp
>T170510 NZ_CP060592:3390952-3391041 [Rouxiella badensis]
GCCTGCATCAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTATTCG
GTCTTTTTTT
GCCTGCATCAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTATTCG
GTCTTTTTTT
Antitoxin
Download Length: 90 bp
>AT170510 NZ_CP060592:c3391041-3390952 [Rouxiella badensis]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TGATGCAGGC
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TGATGCAGGC