Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2331780..2331920 | Replicon | chromosome |
Accession | NZ_CP060440 | ||
Organism | Serratia marcescens strain M158-1-1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2331780..2331876 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2331780..2331920 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
H3V66_RS11160 | 2327070..2327906 | + | 837 | WP_240024252.1 | aminoglycoside phosphotransferase family protein | - |
H3V66_RS11165 | 2327946..2328296 | - | 351 | WP_004940949.1 | DUF4377 domain-containing protein | - |
H3V66_RS11170 | 2328432..2328839 | - | 408 | WP_126178904.1 | hypothetical protein | - |
H3V66_RS11175 | 2329907..2330716 | + | 810 | WP_126193023.1 | hypothetical protein | - |
H3V66_RS11180 | 2330927..2331061 | - | 135 | WP_240024253.1 | DUF1367 family protein | - |
H3V66_RS11185 | 2331127..2331702 | + | 576 | Protein_2201 | tyrosine-type recombinase/integrase | - |
- | 2331780..2331876 | - | 97 | - | - | Toxin |
- | 2331780..2331920 | + | 141 | - | - | Antitoxin |
H3V66_RS11190 | 2332018..2332359 | - | 342 | WP_025302452.1 | YebY family protein | - |
H3V66_RS11195 | 2332429..2333310 | - | 882 | WP_060440195.1 | copper homeostasis membrane protein CopD | - |
H3V66_RS11200 | 2333313..2333696 | - | 384 | WP_004940886.1 | CopC domain-containing protein YobA | - |
H3V66_RS11205 | 2334021..2334539 | - | 519 | WP_038875847.1 | non-heme ferritin | - |
H3V66_RS11210 | 2334884..2335114 | + | 231 | WP_033638067.1 | DNA polymerase III subunit theta | - |
H3V66_RS11215 | 2335148..2336101 | - | 954 | WP_126180338.1 | prolyl aminopeptidase | - |
H3V66_RS11220 | 2336296..2336721 | - | 426 | WP_033653830.1 | RNA polymerase-binding protein DksA | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T170383 NZ_CP060440:c2331876-2331780 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT170383 NZ_CP060440:2331780-2331920 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG