Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 552791..552936 | Replicon | chromosome |
Accession | NZ_CP058752 | ||
Organism | Klebsiella pneumoniae strain STLIN_19 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 552827..552929 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 552791..552936 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
HZT05_RS02730 | 547921..549981 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
HZT05_RS02735 | 549985..550644 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
HZT05_RS02740 | 550723..550953 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
HZT05_RS02745 | 551066..551440 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
HZT05_RS02750 | 551444..552313 | + | 870 | WP_023280292.1 | copper homeostasis membrane protein CopD | - |
HZT05_RS02755 | 552330..552668 | + | 339 | WP_240726274.1 | YebY family protein | - |
- | 552791..552936 | - | 146 | - | - | Antitoxin |
- | 552827..552929 | + | 103 | - | - | Toxin |
HZT05_RS02760 | 553305..553448 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
HZT05_RS02765 | 553553..554521 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
HZT05_RS02770 | 554678..555331 | + | 654 | WP_038807473.1 | protein-serine/threonine phosphatase | - |
HZT05_RS02775 | 555328..555519 | - | 192 | WP_002911395.1 | YebW family protein | - |
HZT05_RS02780 | 555617..555856 | - | 240 | WP_002911393.1 | YebV family protein | - |
HZT05_RS02785 | 555972..557405 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 482067..570334 | 88267 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T167364 NZ_CP058752:552827-552929 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT167364 NZ_CP058752:c552936-552791 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT