Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3334131..3334276 | Replicon | chromosome |
Accession | NZ_CP058325 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain LC-1825/18 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3334138..3334240 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3334131..3334276 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
GLO21_RS16430 (GLO21_016435) | 3329663..3331096 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
GLO21_RS16435 (GLO21_016440) | 3331212..3331451 | + | 240 | WP_002911393.1 | YebV family protein | - |
GLO21_RS16440 (GLO21_016445) | 3331549..3331740 | + | 192 | WP_002911395.1 | YebW family protein | - |
GLO21_RS16445 (GLO21_016450) | 3331737..3332390 | - | 654 | WP_002911396.1 | protein-serine/threonine phosphatase | - |
GLO21_RS16450 (GLO21_016455) | 3332547..3333515 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
GLO21_RS16455 (GLO21_016460) | 3333620..3333763 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 3334131..3334276 | + | 146 | - | - | Antitoxin |
- | 3334138..3334240 | - | 103 | - | - | Toxin |
GLO21_RS16460 (GLO21_016465) | 3334399..3334737 | - | 339 | WP_002911404.1 | YebY family protein | - |
GLO21_RS16465 (GLO21_016470) | 3334754..3335623 | - | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
GLO21_RS16470 (GLO21_016475) | 3335627..3336001 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
GLO21_RS16475 (GLO21_016480) | 3336114..3336344 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
GLO21_RS16480 (GLO21_016485) | 3336423..3337082 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
GLO21_RS16485 (GLO21_016490) | 3337086..3339146 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T166558 NZ_CP058325:c3334240-3334138 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT166558 NZ_CP058325:3334131-3334276 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT