Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2219057..2219200 | Replicon | chromosome |
Accession | NZ_CP056907 | ||
Organism | Citrobacter freundii strain RHBSTW-00011 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2219092..2219195 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2219057..2219200 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
HV032_RS10540 | 2215504..2216166 | - | 663 | WP_181634583.1 | exodeoxyribonuclease X | - |
HV032_RS10545 | 2216190..2216846 | - | 657 | WP_181634584.1 | carbon-nitrogen hydrolase family protein | - |
HV032_RS10550 | 2216953..2217183 | - | 231 | WP_003034925.1 | DNA polymerase III subunit theta | - |
HV032_RS10555 | 2217327..2217701 | + | 375 | WP_047410546.1 | CopC domain-containing protein YobA | - |
HV032_RS10560 | 2217705..2218577 | + | 873 | WP_043016685.1 | copper homeostasis membrane protein CopD | - |
HV032_RS10565 | 2218598..2218936 | + | 339 | WP_043016684.1 | YebY family protein | - |
- | 2219057..2219200 | - | 144 | - | - | Antitoxin |
- | 2219092..2219195 | + | 104 | - | - | Toxin |
HV032_RS10570 | 2219328..2220407 | - | 1080 | WP_148373922.1 | phage integrase Arm DNA-binding domain-containing protein | - |
HV032_RS10575 | 2220385..2220645 | - | 261 | WP_072211989.1 | hypothetical protein | - |
HV032_RS10580 | 2220702..2220942 | - | 241 | Protein_2070 | DUF4060 family protein | - |
HV032_RS10585 | 2220920..2221222 | - | 303 | WP_181634585.1 | hypothetical protein | - |
HV032_RS10590 | 2221219..2223051 | - | 1833 | WP_181634586.1 | hypothetical protein | - |
HV032_RS10595 | 2223385..2223570 | - | 186 | WP_175330400.1 | hypothetical protein | - |
HV032_RS10600 | 2223563..2223757 | - | 195 | WP_181634587.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2211841..2273402 | 61561 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T164452 NZ_CP056907:2219092-2219195 [Citrobacter freundii]
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT164452 NZ_CP056907:c2219200-2219057 [Citrobacter freundii]
CAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT
CAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT