Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2996185..2996327 | Replicon | chromosome |
Accession | NZ_CP056899 | ||
Organism | Citrobacter sp. RHBSTW-00017 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2996189..2996292 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2996185..2996327 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
HV037_RS14585 | 2992453..2993493 | + | 1041 | WP_049040226.1 | recombinase RecT | - |
HV037_RS14590 | 2993528..2993872 | + | 345 | WP_049040227.1 | hypothetical protein | - |
HV037_RS14595 | 2993865..2994491 | + | 627 | WP_049040228.1 | morphogenetic protein | - |
HV037_RS14600 | 2994478..2994720 | + | 243 | WP_005121071.1 | DUF4060 family protein | - |
HV037_RS14605 | 2994785..2995057 | + | 273 | WP_049040229.1 | excisionase | - |
HV037_RS14610 | 2995026..2996111 | + | 1086 | WP_049040230.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2996185..2996327 | + | 143 | - | - | Antitoxin |
- | 2996189..2996292 | - | 104 | - | - | Toxin |
HV037_RS14615 | 2996448..2996786 | - | 339 | WP_003833793.1 | YebY family protein | - |
HV037_RS14620 | 2996807..2997679 | - | 873 | WP_103283918.1 | copper homeostasis membrane protein CopD | - |
HV037_RS14625 | 2997683..2998057 | - | 375 | WP_103283919.1 | CopC domain-containing protein YobA | - |
HV037_RS14630 | 2998201..2998431 | + | 231 | WP_003034925.1 | DNA polymerase III subunit theta | - |
HV037_RS14635 | 2998538..2999194 | + | 657 | WP_016156222.1 | carbon-nitrogen hydrolase family protein | - |
HV037_RS14640 | 2999218..2999880 | + | 663 | WP_016152773.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2935865..3030455 | 94590 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T164437 NZ_CP056899:c2996292-2996189 [Citrobacter sp. RHBSTW-00017]
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATTGTATTCGGTCTCTTTTT
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATTGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 143 bp
>AT164437 NZ_CP056899:2996185-2996327 [Citrobacter sp. RHBSTW-00017]
AGATAAAAAGAGACCGAATACAATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT
AGATAAAAAGAGACCGAATACAATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT