Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2956324..2956466 | Replicon | chromosome |
Accession | NZ_CP056896 | ||
Organism | Citrobacter sp. RHBSTW-00021 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2956328..2956431 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2956324..2956466 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
HV039_RS14395 | 2952592..2953632 | + | 1041 | WP_049040226.1 | recombinase RecT | - |
HV039_RS14400 | 2953667..2954011 | + | 345 | WP_049040227.1 | hypothetical protein | - |
HV039_RS14405 | 2954004..2954630 | + | 627 | WP_049040228.1 | morphogenetic protein | - |
HV039_RS14410 | 2954617..2954859 | + | 243 | WP_005121071.1 | DUF4060 family protein | - |
HV039_RS14415 | 2954924..2955196 | + | 273 | WP_049040229.1 | excisionase | - |
HV039_RS14420 | 2955165..2956250 | + | 1086 | WP_049040230.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2956324..2956466 | + | 143 | - | - | Antitoxin |
- | 2956328..2956431 | - | 104 | - | - | Toxin |
HV039_RS14425 | 2956587..2956925 | - | 339 | WP_003833793.1 | YebY family protein | - |
HV039_RS14430 | 2956946..2957818 | - | 873 | WP_103283918.1 | copper homeostasis membrane protein CopD | - |
HV039_RS14435 | 2957822..2958196 | - | 375 | WP_103283919.1 | CopC domain-containing protein YobA | - |
HV039_RS14440 | 2958340..2958570 | + | 231 | WP_003034925.1 | DNA polymerase III subunit theta | - |
HV039_RS14445 | 2958677..2959333 | + | 657 | WP_016156222.1 | carbon-nitrogen hydrolase family protein | - |
HV039_RS14450 | 2959357..2960019 | + | 663 | WP_016152773.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2893271..2991414 | 98143 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T164416 NZ_CP056896:c2956431-2956328 [Citrobacter sp. RHBSTW-00021]
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATTGTATTCGGTCTCTTTTT
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATTGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 143 bp
>AT164416 NZ_CP056896:2956324-2956466 [Citrobacter sp. RHBSTW-00021]
AGATAAAAAGAGACCGAATACAATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT
AGATAAAAAGAGACCGAATACAATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT