Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2998927..2999067 | Replicon | chromosome |
Accession | NZ_CP056256 | ||
Organism | Citrobacter freundii strain RHBSTW-00902 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2998929..2999032 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2998927..2999067 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
HV319_RS14650 | 2994166..2994399 | - | 234 | Protein_2880 | RusA family crossover junction endodeoxyribonuclease | - |
HV319_RS14655 | 2994402..2994602 | - | 201 | WP_057108923.1 | hypothetical protein | - |
HV319_RS14660 | 2994608..2995195 | - | 588 | WP_181501844.1 | DUF1367 family protein | - |
HV319_RS14665 | 2995219..2996171 | + | 953 | Protein_2883 | IS3 family transposase | - |
HV319_RS14670 | 2996383..2997453 | + | 1071 | WP_001180631.1 | IS110 family transposase | - |
HV319_RS14675 | 2997461..2997676 | + | 216 | Protein_2885 | transposase | - |
HV319_RS14680 | 2997766..2998851 | + | 1086 | WP_181501845.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2998927..2999067 | + | 141 | - | - | Antitoxin |
- | 2998929..2999032 | - | 104 | - | - | Toxin |
HV319_RS14685 | 2999188..2999526 | - | 339 | WP_003034934.1 | YebY family protein | - |
HV319_RS14690 | 2999547..3000419 | - | 873 | WP_032935389.1 | copper homeostasis membrane protein CopD | - |
HV319_RS14695 | 3000423..3000797 | - | 375 | WP_181501846.1 | CopC domain-containing protein YobA | - |
HV319_RS14700 | 3000941..3001171 | + | 231 | WP_003034925.1 | DNA polymerase III subunit theta | - |
HV319_RS14705 | 3001278..3001934 | + | 657 | WP_003841657.1 | carbon-nitrogen hydrolase family protein | - |
HV319_RS14710 | 3001958..3002620 | + | 663 | WP_003833802.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T163152 NZ_CP056256:c2999032-2998929 [Citrobacter freundii]
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 141 bp
>AT163152 NZ_CP056256:2998927-2999067 [Citrobacter freundii]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT