Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2155577..2155718 | Replicon | chromosome |
Accession | NZ_CP056245 | ||
Organism | Citrobacter freundii strain RHBSTW-00915 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2155612..2155715 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2155577..2155718 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
HV325_RS10540 | 2152024..2152686 | - | 663 | WP_003833802.1 | exodeoxyribonuclease X | - |
HV325_RS10545 | 2152710..2153366 | - | 657 | WP_046671220.1 | carbon-nitrogen hydrolase family protein | - |
HV325_RS10550 | 2153473..2153703 | - | 231 | WP_003034925.1 | DNA polymerase III subunit theta | - |
HV325_RS10555 | 2153847..2154221 | + | 375 | WP_044711069.1 | CopC domain-containing protein YobA | - |
HV325_RS10560 | 2154225..2155097 | + | 873 | WP_032935389.1 | copper homeostasis membrane protein CopD | - |
HV325_RS10565 | 2155118..2155456 | + | 339 | WP_003034934.1 | YebY family protein | - |
- | 2155577..2155718 | - | 142 | - | - | Antitoxin |
- | 2155612..2155715 | + | 104 | - | - | Toxin |
HV325_RS10570 | 2155848..2156927 | - | 1080 | WP_049016043.1 | phage integrase Arm DNA-binding domain-containing protein | - |
HV325_RS10575 | 2156905..2157165 | - | 261 | WP_049016044.1 | hypothetical protein | - |
HV325_RS10580 | 2157452..2159299 | - | 1848 | WP_049016093.1 | hypothetical protein | - |
HV325_RS10585 | 2159633..2159818 | - | 186 | WP_049016045.1 | hypothetical protein | - |
HV325_RS10590 | 2159811..2160005 | - | 195 | WP_049025790.1 | hypothetical protein | - |
HV325_RS10595 | 2160373..2160636 | + | 264 | WP_071891820.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2086924..2216141 | 129217 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T163112 NZ_CP056245:2155612-2155715 [Citrobacter freundii]
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 142 bp
>AT163112 NZ_CP056245:c2155718-2155577 [Citrobacter freundii]
GATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGG
CATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT
GATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGG
CATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT