Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2994363..2994503 | Replicon | chromosome |
Accession | NZ_CP056238 | ||
Organism | Citrobacter freundii strain RHBSTW-00935 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2994365..2994468 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2994363..2994503 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
HV330_RS14630 | 2989602..2989835 | - | 234 | Protein_2876 | RusA family crossover junction endodeoxyribonuclease | - |
HV330_RS14635 | 2989838..2990038 | - | 201 | WP_057108923.1 | hypothetical protein | - |
HV330_RS14640 | 2990044..2990631 | - | 588 | WP_181501844.1 | DUF1367 family protein | - |
HV330_RS14645 | 2990655..2991607 | + | 953 | Protein_2879 | IS3 family transposase | - |
HV330_RS14650 | 2991819..2992889 | + | 1071 | WP_001180631.1 | IS110 family transposase | - |
HV330_RS14655 | 2992897..2993112 | + | 216 | Protein_2881 | transposase | - |
HV330_RS14660 | 2993202..2994287 | + | 1086 | WP_181501845.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2994363..2994503 | + | 141 | - | - | Antitoxin |
- | 2994365..2994468 | - | 104 | - | - | Toxin |
HV330_RS14665 | 2994624..2994962 | - | 339 | WP_003034934.1 | YebY family protein | - |
HV330_RS14670 | 2994983..2995855 | - | 873 | WP_032935389.1 | copper homeostasis membrane protein CopD | - |
HV330_RS14675 | 2995859..2996233 | - | 375 | WP_181501846.1 | CopC domain-containing protein YobA | - |
HV330_RS14680 | 2996377..2996607 | + | 231 | WP_003034925.1 | DNA polymerase III subunit theta | - |
HV330_RS14685 | 2996714..2997370 | + | 657 | WP_003841657.1 | carbon-nitrogen hydrolase family protein | - |
HV330_RS14690 | 2997394..2998056 | + | 663 | WP_003833802.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T163076 NZ_CP056238:c2994468-2994365 [Citrobacter freundii]
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 141 bp
>AT163076 NZ_CP056238:2994363-2994503 [Citrobacter freundii]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT