Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1853522..1853662 | Replicon | chromosome |
| Accession | NZ_CP055096 | ||
| Organism | Klebsiella pneumoniae strain SWHIN_108 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1853558..1853660 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1853522..1853662 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HUZ85_RS08985 | 1848654..1850714 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
| HUZ85_RS08990 | 1850718..1851377 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
| HUZ85_RS08995 | 1851456..1851686 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
| HUZ85_RS09000 | 1851797..1852171 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
| HUZ85_RS09005 | 1852175..1853044 | + | 870 | WP_023282759.1 | copper homeostasis membrane protein CopD | - |
| HUZ85_RS09010 | 1853061..1853399 | + | 339 | WP_002911404.1 | YebY family protein | - |
| - | 1853522..1853662 | - | 141 | - | - | Antitoxin |
| - | 1853558..1853660 | + | 103 | - | - | Toxin |
| HUZ85_RS09015 | 1853738..1854823 | - | 1086 | WP_064190563.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| HUZ85_RS09020 | 1854792..1855064 | - | 273 | WP_074194905.1 | excisionase | - |
| HUZ85_RS09025 | 1855146..1855313 | - | 168 | WP_102016074.1 | hypothetical protein | - |
| HUZ85_RS09030 | 1855352..1855612 | - | 261 | WP_080882102.1 | hypothetical protein | - |
| HUZ85_RS09035 | 1855803..1855970 | - | 168 | WP_074194906.1 | DUF2737 family protein | - |
| HUZ85_RS09040 | 1856019..1856303 | - | 285 | WP_064190564.1 | hypothetical protein | - |
| HUZ85_RS09045 | 1856353..1856937 | - | 585 | WP_064190565.1 | hypothetical protein | - |
| HUZ85_RS09050 | 1856934..1857614 | - | 681 | WP_064190566.1 | AAA family ATPase | - |
| HUZ85_RS09055 | 1857596..1857763 | - | 168 | WP_162779418.1 | hypothetical protein | - |
| HUZ85_RS09060 | 1858052..1858333 | - | 282 | WP_074194907.1 | hypothetical protein | - |
| HUZ85_RS09065 | 1858320..1858484 | - | 165 | WP_077259629.1 | host cell division inhibitory peptide Kil | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 1832923..1920407 | 87484 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T161471 NZ_CP055096:1853558-1853660 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 141 bp
>AT161471 NZ_CP055096:c1853662-1853522 [Klebsiella pneumoniae]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
