Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 5049246..5049386 | Replicon | chromosome |
Accession | NZ_CP054277 | ||
Organism | Serratia marcescens strain Byron |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 5049290..5049386 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 5049246..5049386 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
HS042_RS23905 | 5044515..5044910 | + | 396 | WP_076740331.1 | RidA family protein | - |
HS042_RS23910 | 5045067..5046020 | + | 954 | WP_025159932.1 | prolyl aminopeptidase | - |
HS042_RS23915 | 5046052..5046282 | - | 231 | WP_019454717.1 | DNA polymerase III subunit theta | - |
HS042_RS23920 | 5046627..5047145 | + | 519 | WP_015377481.1 | non-heme ferritin | - |
HS042_RS23925 | 5047437..5047853 | + | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
HS042_RS23930 | 5047856..5048737 | + | 882 | WP_196405952.1 | copper homeostasis membrane protein CopD | - |
HS042_RS23935 | 5048807..5049148 | + | 342 | WP_004940890.1 | YebY family protein | - |
- | 5049246..5049386 | - | 141 | - | - | Antitoxin |
- | 5049290..5049386 | + | 97 | - | - | Toxin |
HS042_RS23940 | 5049464..5049776 | - | 313 | Protein_4658 | tyrosine-type recombinase/integrase | - |
HS042_RS23945 | 5050129..5050272 | + | 144 | WP_139319811.1 | hypothetical protein | - |
HS042_RS23950 | 5050274..5051716 | - | 1443 | WP_160125476.1 | glucosyltransferase domain-containing protein | - |
HS042_RS23955 | 5051730..5052641 | - | 912 | WP_160125373.1 | glycosyltransferase family 2 protein | - |
HS042_RS23960 | 5052638..5052994 | - | 357 | WP_072271515.1 | GtrA family protein | - |
HS042_RS23965 | 5053386..5053913 | + | 528 | WP_075685382.1 | ImpB/MucB/SamB family protein | - |
HS042_RS23970 | 5054041..5054241 | + | 201 | WP_160125374.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | gtrB | 5041232..5053913 | 12681 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T159286 NZ_CP054277:5049290-5049386 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT159286 NZ_CP054277:c5049386-5049246 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG