Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3241689..3241784 | Replicon | chromosome |
Accession | NZ_CP054043 | ||
Organism | Yersinia mollaretii ATCC 43969 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3241689..3241783 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3241689..3241784 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
HRD69_RS14430 | 3237279..3238235 | + | 957 | WP_032814983.1 | prolyl aminopeptidase | - |
HRD69_RS14435 | 3238291..3238521 | - | 231 | WP_004875994.1 | DNA polymerase III subunit theta | - |
HRD69_RS14440 | 3238913..3239422 | + | 510 | WP_004875993.1 | non-heme ferritin | - |
HRD69_RS14445 | 3239807..3240193 | + | 387 | WP_032814982.1 | CopC domain-containing protein YobA | - |
HRD69_RS14450 | 3240195..3241079 | + | 885 | WP_004875991.1 | copper homeostasis membrane protein CopD | - |
HRD69_RS14455 | 3241176..3241517 | + | 342 | WP_004875990.1 | YebY family protein | - |
- | 3241689..3241783 | + | 95 | - | - | Toxin |
- | 3241689..3241784 | - | 96 | - | - | Antitoxin |
HRD69_RS14460 | 3241860..3242462 | - | 603 | WP_032814994.1 | tyrosine-type recombinase/integrase | - |
HRD69_RS14465 | 3242669..3243061 | + | 393 | WP_004875988.1 | tail fiber assembly protein | - |
HRD69_RS14470 | 3243097..3243396 | - | 300 | WP_004875987.1 | DUF1493 family protein | - |
HRD69_RS14475 | 3243390..3243857 | - | 468 | WP_032814980.1 | hypothetical protein | - |
HRD69_RS14480 | 3244188..3244745 | + | 558 | WP_004875985.1 | hypothetical protein | - |
HRD69_RS14485 | 3245049..3245165 | - | 117 | Protein_2806 | phage baseplate assembly protein V | - |
HRD69_RS14490 | 3245342..3245713 | + | 372 | WP_032814977.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 3238291..3249834 | 11543 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 95 bp
>T158552 NZ_CP054043:3241689-3241783 [Yersinia mollaretii ATCC 43969]
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTCTTTTT
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTCTTTTT
Antitoxin
Download Length: 96 bp
>AT158552 NZ_CP054043:c3241784-3241689 [Yersinia mollaretii ATCC 43969]
TAAAAAGAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAACGTAGGCTTGTT
TAAAAAGAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAACGTAGGCTTGTT