Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 5183735..5183880 | Replicon | chromosome |
Accession | NZ_CP053771 | ||
Organism | Klebsiella pneumoniae strain BP3636 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 5183771..5183873 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 5183735..5183880 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
HBJ33_RS24875 | 5178865..5180925 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
HBJ33_RS24880 | 5180929..5181588 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
HBJ33_RS24885 | 5181667..5181897 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
HBJ33_RS24890 | 5182010..5182384 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
HBJ33_RS24895 | 5182388..5183257 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
HBJ33_RS24900 | 5183274..5183612 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 5183735..5183880 | - | 146 | - | - | Antitoxin |
- | 5183771..5183873 | + | 103 | - | - | Toxin |
HBJ33_RS24905 | 5184249..5184392 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
HBJ33_RS24910 | 5184497..5185465 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
HBJ33_RS24915 | 5185622..5186275 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
HBJ33_RS24920 | 5186272..5186463 | - | 192 | WP_002911395.1 | YebW family protein | - |
HBJ33_RS24925 | 5186561..5186800 | - | 240 | WP_002911393.1 | YebV family protein | - |
HBJ33_RS24930 | 5186916..5188349 | - | 1434 | WP_179108510.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 5110682..5202937 | 92255 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T157779 NZ_CP053771:5183771-5183873 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT157779 NZ_CP053771:c5183880-5183735 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT