Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1952720..1952860 | Replicon | chromosome |
Accession | NZ_CP053572 | ||
Organism | Serratia marcescens strain S7.1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1952764..1952860 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1952720..1952860 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
F0335_RS09275 | 1947920..1948345 | + | 426 | WP_107226957.1 | RNA polymerase-binding protein DksA | - |
F0335_RS09280 | 1948540..1949493 | + | 954 | WP_063990329.1 | prolyl aminopeptidase | - |
F0335_RS09285 | 1949527..1949757 | - | 231 | WP_149559950.1 | DNA polymerase III subunit theta | - |
F0335_RS09290 | 1950102..1950620 | + | 519 | WP_025302449.1 | non-heme ferritin | - |
F0335_RS09295 | 1950945..1951328 | + | 384 | WP_004940886.1 | CopC domain-containing protein YobA | - |
F0335_RS09300 | 1951331..1952212 | + | 882 | WP_063989547.1 | copper homeostasis membrane protein CopD | - |
F0335_RS09305 | 1952282..1952622 | + | 341 | Protein_1791 | YebY family protein | - |
- | 1952720..1952860 | - | 141 | - | - | Antitoxin |
- | 1952764..1952860 | + | 97 | - | - | Toxin |
F0335_RS09310 | 1952939..1953295 | - | 357 | WP_149559953.1 | integrase | - |
F0335_RS09315 | 1953342..1953941 | + | 600 | WP_149559949.1 | hypothetical protein | - |
F0335_RS09320 | 1953932..1954240 | + | 309 | WP_149559948.1 | hypothetical protein | - |
F0335_RS09325 | 1954355..1955365 | + | 1011 | WP_149559947.1 | P63C domain-containing protein | - |
F0335_RS09330 | 1955643..1956086 | - | 444 | WP_175089902.1 | hypothetical protein | - |
F0335_RS09335 | 1956258..1956458 | + | 201 | WP_149559945.1 | hypothetical protein | - |
F0335_RS09340 | 1956463..1956843 | + | 381 | Protein_1798 | lysozyme | - |
F0335_RS09345 | 1957120..1957773 | - | 654 | WP_149559944.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1946828..1956873 | 10045 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T156858 NZ_CP053572:1952764-1952860 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT156858 NZ_CP053572:c1952860-1952720 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGTCTACCACGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGTCTACCACGCCAGTTTTGCCAG