Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3399630..3399833 | Replicon | chromosome |
Accession | NZ_CP052870 | ||
Organism | Enterobacter cloacae strain 3849 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3399637..3399740 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3399630..3399833 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
HJI43_RS16235 | 3394635..3395063 | + | 429 | WP_063921947.1 | hypothetical protein | - |
HJI43_RS16240 | 3395060..3395212 | + | 153 | WP_169441203.1 | DUF1317 family protein | - |
HJI43_RS16245 | 3395209..3395868 | + | 660 | WP_169441204.1 | DNA methyltransferase | - |
HJI43_RS16250 | 3395865..3396080 | + | 216 | WP_169441206.1 | hypothetical protein | - |
HJI43_RS16255 | 3396080..3396376 | + | 297 | WP_169441208.1 | DUF4406 domain-containing protein | - |
HJI43_RS16260 | 3396373..3396564 | + | 192 | WP_120157928.1 | DUF1382 family protein | - |
HJI43_RS16265 | 3396656..3396874 | + | 219 | WP_169441209.1 | TraR/DksA family transcriptional regulator | - |
HJI43_RS16270 | 3396883..3397092 | + | 210 | WP_032677372.1 | hypothetical protein | - |
HJI43_RS16275 | 3397089..3397538 | + | 450 | WP_072210197.1 | DUF2591 family protein | - |
HJI43_RS16280 | 3397501..3397740 | + | 240 | Protein_3173 | DUF4222 domain-containing protein | - |
HJI43_RS16285 | 3397750..3398076 | + | 327 | WP_169441211.1 | DUF550 domain-containing protein | - |
HJI43_RS16290 | 3398233..3398505 | + | 273 | WP_023300430.1 | hypothetical protein | - |
HJI43_RS16295 | 3398474..3399559 | + | 1086 | WP_169441213.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 3399630..3399833 | + | 204 | - | - | Antitoxin |
- | 3399637..3399740 | - | 104 | - | - | Toxin |
HJI43_RS16300 | 3399883..3400221 | - | 339 | WP_022648464.1 | YebY family protein | - |
HJI43_RS16305 | 3400238..3401107 | - | 870 | WP_046619433.1 | copper homeostasis membrane protein CopD | - |
HJI43_RS16310 | 3401109..3401480 | - | 372 | WP_023300433.1 | CopC domain-containing protein YobA | - |
HJI43_RS16315 | 3401618..3401848 | + | 231 | WP_003859784.1 | DNA polymerase III subunit theta | - |
HJI43_RS16320 | 3401960..3402598 | + | 639 | WP_023300434.1 | carbon-nitrogen hydrolase family protein | - |
HJI43_RS16325 | 3402623..3403285 | + | 663 | WP_022648468.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | gtrA / gtrB | 3335345..3406068 | 70723 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T155680 NZ_CP052870:c3399740-3399637 [Enterobacter cloacae]
GGCAAGGCGATTGAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTGAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 204 bp
>AT155680 NZ_CP052870:3399630-3399833 [Enterobacter cloacae]
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTCAATCGCCTTGCCCTTTAAGAATAGATGACGACGTCAGGTTTTCCAGTCCACAGTAAAAGTG
GTCTGAAAAAAAGCGTCAGAACATCACTAAATGTGAAAAACCGC
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTCAATCGCCTTGCCCTTTAAGAATAGATGACGACGTCAGGTTTTCCAGTCCACAGTAAAAGTG
GTCTGAAAAAAAGCGTCAGAACATCACTAAATGTGAAAAACCGC