Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 3451099..3451244 | Replicon | chromosome |
| Accession | NZ_CP050520 | ||
| Organism | Enterobacter sp. DNB-S2 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 3451106..3451209 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 3451099..3451244 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HB664_RS16510 (HB664_16515) | 3446449..3446601 | + | 153 | WP_006809793.1 | DUF1317 family protein | - |
| HB664_RS16515 (HB664_16520) | 3446598..3447080 | + | 483 | WP_219939844.1 | class I SAM-dependent methyltransferase | - |
| HB664_RS16520 (HB664_16525) | 3447077..3447736 | + | 660 | WP_219939845.1 | MT-A70 family methyltransferase | - |
| HB664_RS16525 (HB664_16530) | 3447733..3447951 | + | 219 | WP_219939846.1 | hypothetical protein | - |
| HB664_RS16530 (HB664_16535) | 3447948..3448256 | + | 309 | WP_219939847.1 | hypothetical protein | - |
| HB664_RS16535 (HB664_16540) | 3448351..3448569 | + | 219 | WP_219939848.1 | TraR/DksA family transcriptional regulator | - |
| HB664_RS16540 (HB664_16545) | 3448571..3449059 | - | 489 | WP_219939849.1 | hypothetical protein | - |
| HB664_RS16545 (HB664_16550) | 3449273..3449536 | + | 264 | Protein_3229 | DUF550 domain-containing protein | - |
| HB664_RS16550 (HB664_16555) | 3449702..3449974 | + | 273 | WP_219939851.1 | excisionase | - |
| HB664_RS16555 (HB664_16560) | 3449943..3451028 | + | 1086 | WP_219939852.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| - | 3451099..3451244 | + | 146 | - | - | Antitoxin |
| - | 3451106..3451209 | - | 104 | - | - | Toxin |
| HB664_RS16560 (HB664_16565) | 3451348..3451686 | - | 339 | WP_033145840.1 | YebY family protein | - |
| HB664_RS16565 (HB664_16570) | 3451703..3452572 | - | 870 | WP_033145841.1 | copper homeostasis membrane protein CopD | - |
| HB664_RS16570 (HB664_16575) | 3452574..3452945 | - | 372 | WP_033145842.1 | CopC domain-containing protein YobA | - |
| HB664_RS16575 (HB664_16580) | 3453082..3453312 | + | 231 | WP_008500465.1 | DNA polymerase III subunit theta | - |
| HB664_RS16580 (HB664_16585) | 3453423..3454073 | + | 651 | WP_033145843.1 | carbon-nitrogen hydrolase family protein | - |
| HB664_RS16585 (HB664_16590) | 3454098..3454760 | + | 663 | WP_010432611.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 3383769..3457550 | 73781 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T153000 NZ_CP050520:c3451209-3451106 [Enterobacter sp. DNB-S2]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT153000 NZ_CP050520:3451099-3451244 [Enterobacter sp. DNB-S2]
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
