Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 301994..302091 | Replicon | chromosome |
Accession | NZ_CP050171 | ||
Organism | Serratia fonticola strain CPSE11 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 301996..302091 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 301994..302082 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
HAP32_RS01415 | 297163..297705 | - | 543 | WP_166732756.1 | hypothetical protein | - |
HAP32_RS01420 | 298133..299404 | - | 1272 | WP_166732757.1 | translesion error-prone DNA polymerase V subunit UmuC | - |
HAP32_RS01425 | 299404..299826 | - | 423 | WP_166732758.1 | translesion error-prone DNA polymerase V autoproteolytic subunit | - |
HAP32_RS01430 | 300049..300528 | - | 480 | WP_071683297.1 | hypothetical protein | - |
HAP32_RS01435 | 300838..301710 | - | 873 | WP_166732759.1 | excinuclease Cho | - |
- | 301994..302082 | + | 89 | - | - | Antitoxin |
- | 301996..302091 | - | 96 | - | - | Toxin |
HAP32_RS01440 | 302232..302573 | - | 342 | WP_166732760.1 | YebY family protein | - |
HAP32_RS01445 | 302643..303524 | - | 882 | WP_166732761.1 | copper homeostasis membrane protein CopD | - |
HAP32_RS01450 | 303528..303911 | - | 384 | WP_024485865.1 | CopC domain-containing protein YobA | - |
HAP32_RS01455 | 304234..304752 | - | 519 | WP_021806759.1 | non-heme ferritin | - |
HAP32_RS01460 | 305140..305370 | + | 231 | WP_021181054.1 | DNA polymerase III subunit theta | - |
HAP32_RS01465 | 305412..306365 | - | 954 | WP_166732762.1 | prolyl aminopeptidase | - |
HAP32_RS01470 | 306478..306915 | - | 438 | WP_021806760.1 | TraR/DksA C4-type zinc finger protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 96 bp
>T152336 NZ_CP050171:c302091-301996 [Serratia fonticola]
AACAAACCTTGCATAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCCTTTCCCTAGACCGAGTATAGGAATCG
TACTCGGTCTTTTTTT
AACAAACCTTGCATAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCCTTTCCCTAGACCGAGTATAGGAATCG
TACTCGGTCTTTTTTT
Antitoxin
Download Length: 89 bp
>AT152336 NZ_CP050171:301994-302082 [Serratia fonticola]
ATAAAAAAAGACCGAGTACGATTCCTATACTCGGTCTAGGGAAAGGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTTATGCA
ATAAAAAAAGACCGAGTACGATTCCTATACTCGGTCTAGGGAAAGGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTTATGCA