Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2438969..2439203 | Replicon | chromosome |
| Accession | NZ_CP049606 | ||
| Organism | Shigella boydii strain 600080 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2438970..2439073 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2438969..2439203 (+) |
Genomic Context
Location: 2434513..2434785 (273 bp)
Type: Others
Protein ID: WP_001277358.1
Type: Others
Protein ID: WP_001277358.1
Location: 2434815..2435912 (1098 bp)
Type: Others
Protein ID: WP_039066158.1
Type: Others
Protein ID: WP_039066158.1
Location: 2435963..2436151 (189 bp)
Type: Others
Protein ID: WP_000276807.1
Type: Others
Protein ID: WP_000276807.1
Location: 2436252..2437408 (1157 bp)
Type: Others
Protein ID: WP_178986836.1
Type: Others
Protein ID: WP_178986836.1
Location: 2437525..2437806 (282 bp)
Type: Others
Protein ID: WP_005127484.1
Type: Others
Protein ID: WP_005127484.1
Location: 2437772..2438848 (1077 bp)
Type: Others
Protein ID: WP_001189100.1
Type: Others
Protein ID: WP_001189100.1
Location: 2438969..2439203 (235 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 2440974..2441204 (231 bp)
Type: Others
Protein ID: WP_000916763.1
Type: Others
Protein ID: WP_000916763.1
Location: 2441306..2441962 (657 bp)
Type: Others
Protein ID: Protein_2452
Type: Others
Protein ID: Protein_2452
Location: 2441986..2442648 (663 bp)
Type: Others
Protein ID: WP_000944270.1
Type: Others
Protein ID: WP_000944270.1
Location: 2435969..2436147 (179 bp)
Type: Others
Protein ID: NuclAT_0
Type: Others
Protein ID: NuclAT_0
Location: 2435969..2436147 (179 bp)
Type: Others
Protein ID: NuclAT_0
Type: Others
Protein ID: NuclAT_0
Location: 2435969..2436147 (179 bp)
Type: Others
Protein ID: NuclAT_0
Type: Others
Protein ID: NuclAT_0
Location: 2435969..2436147 (179 bp)
Type: Others
Protein ID: NuclAT_0
Type: Others
Protein ID: NuclAT_0
Location: 2438970..2439073 (104 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 2439231..2439572 (342 bp)
Type: Others
Protein ID: WP_073705566.1
Type: Others
Protein ID: WP_073705566.1
Location: 2439585..2440457 (873 bp)
Type: Others
Protein ID: WP_039066159.1
Type: Others
Protein ID: WP_039066159.1
Location: 2440461..2440835 (375 bp)
Type: Others
Protein ID: WP_000168747.1
Type: Others
Protein ID: WP_000168747.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| G5S61_RS12325 | 2434513..2434785 | + | 273 | WP_001277358.1 | host-nuclease inhibitor Gam family protein | - |
| G5S61_RS12330 | 2434815..2435912 | + | 1098 | WP_039066158.1 | AAA family ATPase | - |
| G5S61_RS12335 | 2435963..2436151 | + | 189 | WP_000276807.1 | DUF1187 family protein | - |
| - | 2435969..2436147 | - | 179 | NuclAT_0 | - | - |
| - | 2435969..2436147 | - | 179 | NuclAT_0 | - | - |
| - | 2435969..2436147 | - | 179 | NuclAT_0 | - | - |
| - | 2435969..2436147 | - | 179 | NuclAT_0 | - | - |
| G5S61_RS12340 | 2436252..2437408 | + | 1157 | WP_178986836.1 | IS3-like element IS600 family transposase | - |
| G5S61_RS12345 | 2437525..2437806 | + | 282 | WP_005127484.1 | excisionase | - |
| G5S61_RS12350 | 2437772..2438848 | + | 1077 | WP_001189100.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| - | 2438969..2439203 | + | 235 | - | - | Antitoxin |
| - | 2438970..2439073 | - | 104 | - | - | Toxin |
| G5S61_RS12355 | 2439231..2439572 | - | 342 | WP_073705566.1 | YebY family protein | - |
| G5S61_RS12360 | 2439585..2440457 | - | 873 | WP_039066159.1 | copper homeostasis membrane protein CopD | - |
| G5S61_RS12365 | 2440461..2440835 | - | 375 | WP_000168747.1 | CopC domain-containing protein YobA | - |
| G5S61_RS12370 | 2440974..2441204 | + | 231 | WP_000916763.1 | DNA polymerase III subunit theta | - |
| G5S61_RS12375 | 2441306..2441962 | + | 657 | Protein_2452 | carbon-nitrogen hydrolase family protein | - |
| G5S61_RS12380 | 2441986..2442648 | + | 663 | WP_000944270.1 | exodeoxyribonuclease X | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Genomic island | - | - | 2417169..2439572 | 22403 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T151368 NZ_CP049606:c2439073-2438970 [Shigella boydii]
GGCAAGGCAACTAAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTTTTTTT
GGCAAGGCAACTAAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTTTTTTT
Antitoxin
Download Length: 235 bp
>AT151368 NZ_CP049606:2438969-2439203 [Shigella boydii]
TAAAAAAAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAATGCAGGCTTAGTTGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCGTGCAAAATGGTCAAT
AAAAAGCGCGGTGGTCATCAGCTTAAATGTTAAAAACCGCCCGTTCTGGTGAAAGAACTGAGGCGGTTTTTTTAT
TAAAAAAAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAATGCAGGCTTAGTTGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCGTGCAAAATGGTCAAT
AAAAAGCGCGGTGGTCATCAGCTTAAATGTTAAAAACCGCCCGTTCTGGTGAAAGAACTGAGGCGGTTTTTTTAT
