Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2179112..2179252 | Replicon | chromosome |
Accession | NZ_CP047691 | ||
Organism | Serratia marcescens strain C110 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2179156..2179252 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2179112..2179252 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
GV213_RS10600 | 2174314..2174739 | + | 426 | WP_033653830.1 | RNA polymerase-binding protein DksA | - |
GV213_RS10605 | 2174932..2175885 | + | 954 | WP_033646426.1 | prolyl aminopeptidase | - |
GV213_RS10610 | 2175917..2176147 | - | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
GV213_RS10615 | 2176493..2177011 | + | 519 | WP_025302449.1 | non-heme ferritin | - |
GV213_RS10620 | 2177336..2177719 | + | 384 | WP_004940886.1 | CopC domain-containing protein YobA | - |
GV213_RS10625 | 2177722..2178603 | + | 882 | WP_047568032.1 | copper homeostasis membrane protein CopD | - |
GV213_RS10630 | 2178673..2179014 | + | 342 | WP_025302452.1 | YebY family protein | - |
- | 2179112..2179252 | - | 141 | - | - | Antitoxin |
- | 2179156..2179252 | + | 97 | - | - | Toxin |
GV213_RS10635 | 2179494..2179898 | + | 405 | WP_047568029.1 | hypothetical protein | - |
GV213_RS10640 | 2179895..2180113 | - | 219 | WP_033638114.1 | hypothetical protein | - |
GV213_RS10645 | 2180177..2180341 | - | 165 | WP_154609290.1 | hypothetical protein | - |
GV213_RS10650 | 2180634..2180984 | + | 351 | WP_047568027.1 | DUF4377 domain-containing protein | - |
GV213_RS10655 | 2181168..2182367 | + | 1200 | WP_033638117.1 | trans-2-enoyl-CoA reductase family protein | - |
GV213_RS10660 | 2182595..2182813 | + | 219 | WP_072021565.1 | hypothetical protein | - |
GV213_RS10665 | 2182985..2183290 | + | 306 | WP_047568025.1 | hypothetical protein | - |
GV213_RS10670 | 2183334..2183669 | + | 336 | WP_047568023.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T147304 NZ_CP047691:2179156-2179252 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT147304 NZ_CP047691:c2179252-2179112 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG