Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2179277..2179417 | Replicon | chromosome |
Accession | NZ_CP047688 | ||
Organism | Serratia marcescens strain 1140- |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2179321..2179417 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2179277..2179417 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
GV224_RS10605 | 2174479..2174904 | + | 426 | WP_033653830.1 | RNA polymerase-binding protein DksA | - |
GV224_RS10610 | 2175097..2176050 | + | 954 | WP_033646426.1 | prolyl aminopeptidase | - |
GV224_RS10615 | 2176082..2176312 | - | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
GV224_RS10620 | 2176658..2177176 | + | 519 | WP_025302449.1 | non-heme ferritin | - |
GV224_RS10625 | 2177501..2177884 | + | 384 | WP_004940886.1 | CopC domain-containing protein YobA | - |
GV224_RS10630 | 2177887..2178768 | + | 882 | WP_047568032.1 | copper homeostasis membrane protein CopD | - |
GV224_RS10635 | 2178838..2179179 | + | 342 | WP_025302452.1 | YebY family protein | - |
- | 2179277..2179417 | - | 141 | - | - | Antitoxin |
- | 2179321..2179417 | + | 97 | - | - | Toxin |
GV224_RS10640 | 2179659..2180063 | + | 405 | WP_047568029.1 | hypothetical protein | - |
GV224_RS10645 | 2180060..2180278 | - | 219 | WP_033638114.1 | hypothetical protein | - |
GV224_RS10650 | 2180342..2180506 | - | 165 | WP_154609290.1 | hypothetical protein | - |
GV224_RS10655 | 2180799..2181149 | + | 351 | WP_047568027.1 | DUF4377 domain-containing protein | - |
GV224_RS10660 | 2181333..2182532 | + | 1200 | WP_033638117.1 | trans-2-enoyl-CoA reductase family protein | - |
GV224_RS10665 | 2182760..2182978 | + | 219 | WP_072021565.1 | hypothetical protein | - |
GV224_RS10670 | 2183150..2183455 | + | 306 | WP_047568025.1 | hypothetical protein | - |
GV224_RS10675 | 2183499..2183834 | + | 336 | WP_047568023.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T147282 NZ_CP047688:2179321-2179417 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT147282 NZ_CP047688:c2179417-2179277 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG