Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2018206..2018351 | Replicon | chromosome |
Accession | NZ_CP047595 | ||
Organism | Klebsiella pneumoniae strain Kpn 1693 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2018242..2018344 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2018206..2018351 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
GTK25_RS09535 | 2013336..2015396 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
GTK25_RS09540 | 2015400..2016059 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
GTK25_RS09545 | 2016138..2016368 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
GTK25_RS09550 | 2016481..2016855 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
GTK25_RS09555 | 2016859..2017728 | + | 870 | WP_014907333.1 | copper homeostasis membrane protein CopD | - |
GTK25_RS09560 | 2017745..2018083 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2018206..2018351 | - | 146 | - | - | Antitoxin |
- | 2018242..2018344 | + | 103 | - | - | Toxin |
GTK25_RS09565 | 2018719..2018862 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
GTK25_RS09570 | 2018967..2019935 | - | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
GTK25_RS09575 | 2020092..2020745 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
GTK25_RS09580 | 2020742..2020933 | - | 192 | WP_002911395.1 | YebW family protein | - |
GTK25_RS09585 | 2021031..2021270 | - | 240 | WP_002911393.1 | YebV family protein | - |
GTK25_RS09590 | 2021386..2022819 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T146845 NZ_CP047595:2018242-2018344 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT146845 NZ_CP047595:c2018351-2018206 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT