Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1971577..1971717 | Replicon | chromosome |
Accession | NZ_CP047391 | ||
Organism | Serratia marcescens strain 1602 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1971621..1971717 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1971577..1971717 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
GRX59_RS09320 | 1966777..1967202 | + | 426 | WP_033638066.1 | RNA polymerase-binding protein DksA | - |
GRX59_RS09325 | 1967395..1968348 | + | 954 | WP_033646426.1 | prolyl aminopeptidase | - |
GRX59_RS09330 | 1968380..1968610 | - | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
GRX59_RS09335 | 1968956..1969474 | + | 519 | WP_025302449.1 | non-heme ferritin | - |
GRX59_RS09340 | 1969768..1970184 | + | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
GRX59_RS09345 | 1970187..1971068 | + | 882 | WP_033646425.1 | copper homeostasis membrane protein CopD | - |
GRX59_RS09350 | 1971138..1971479 | + | 342 | WP_025302452.1 | YebY family protein | - |
- | 1971577..1971717 | - | 141 | - | - | Antitoxin |
- | 1971621..1971717 | + | 97 | - | - | Toxin |
GRX59_RS09355 | 1971970..1972374 | + | 405 | WP_060437911.1 | hypothetical protein | - |
GRX59_RS09360 | 1972371..1972589 | - | 219 | WP_004940942.1 | hypothetical protein | - |
GRX59_RS09365 | 1972653..1972817 | - | 165 | WP_154067227.1 | hypothetical protein | - |
GRX59_RS09370 | 1973109..1973459 | + | 351 | WP_033638116.1 | DUF4377 domain-containing protein | - |
GRX59_RS09375 | 1973643..1974842 | + | 1200 | WP_033638117.1 | trans-2-enoyl-CoA reductase family protein | - |
GRX59_RS09380 | 1975070..1975288 | + | 219 | WP_033646423.1 | hypothetical protein | - |
GRX59_RS09385 | 1975460..1975765 | + | 306 | WP_033646422.1 | hypothetical protein | - |
GRX59_RS09390 | 1975809..1976144 | + | 336 | WP_033638120.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T146137 NZ_CP047391:1971621-1971717 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT146137 NZ_CP047391:c1971717-1971577 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG