Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1888927..1889072 | Replicon | chromosome |
| Accession | NZ_CP047283 | ||
| Organism | Klebsiella quasipneumoniae strain N18-04116 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1888968..1889070 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1888927..1889072 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| F3137_RS09065 | 1884062..1886122 | + | 2061 | WP_004203388.1 | oligopeptidase B | - |
| F3137_RS09070 | 1886126..1886785 | - | 660 | WP_004203387.1 | exodeoxyribonuclease X | - |
| F3137_RS09075 | 1886864..1887094 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
| F3137_RS09080 | 1887207..1887581 | + | 375 | WP_004203386.1 | CopC domain-containing protein YobA | - |
| F3137_RS09085 | 1887585..1888454 | + | 870 | WP_004203385.1 | copper homeostasis membrane protein CopD | - |
| F3137_RS09090 | 1888471..1888809 | + | 339 | WP_002911404.1 | YebY family protein | - |
| - | 1888927..1889072 | - | 146 | - | - | Antitoxin |
| - | 1888968..1889070 | + | 103 | - | - | Toxin |
| F3137_RS09095 | 1889148..1890233 | - | 1086 | WP_183468502.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| F3137_RS09100 | 1890202..1890474 | - | 273 | WP_183468504.1 | excisionase | - |
| F3137_RS09105 | 1890602..1890790 | - | 189 | WP_183468505.1 | hypothetical protein | - |
| F3137_RS09110 | 1890819..1891448 | - | 630 | Protein_1780 | Eac protein | - |
| F3137_RS09115 | 1891510..1891767 | - | 258 | WP_183468507.1 | DNA polymerase III subunit theta | - |
| F3137_RS09120 | 1891813..1892046 | - | 234 | WP_183468509.1 | hypothetical protein | - |
| F3137_RS09125 | 1892085..1892309 | - | 225 | WP_016831923.1 | hypothetical protein | - |
| F3137_RS09130 | 1892299..1892607 | - | 309 | WP_183468511.1 | hypothetical protein | - |
| F3137_RS09135 | 1892604..1893251 | - | 648 | WP_183468512.1 | hypothetical protein | - |
| F3137_RS09140 | 1893253..1893744 | - | 492 | WP_100631103.1 | HNH endonuclease | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 1884095..1957515 | 73420 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T145788 NZ_CP047283:1888968-1889070 [Klebsiella quasipneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT145788 NZ_CP047283:c1889072-1888927 [Klebsiella quasipneumoniae]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG
