Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2045667..2045812 | Replicon | chromosome |
Accession | NZ_CP046962 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WCHKP020130 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2045703..2045805 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2045667..2045812 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CLQ86_RS10015 (CLQ86_09895) | 2040797..2042857 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
CLQ86_RS10020 (CLQ86_09900) | 2042861..2043520 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
CLQ86_RS10025 (CLQ86_09905) | 2043599..2043829 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
CLQ86_RS10030 (CLQ86_09910) | 2043942..2044316 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
CLQ86_RS10035 (CLQ86_09915) | 2044320..2045189 | + | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
CLQ86_RS10040 (CLQ86_09920) | 2045206..2045544 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2045667..2045812 | - | 146 | - | - | Antitoxin |
- | 2045703..2045805 | + | 103 | - | - | Toxin |
CLQ86_RS10045 (CLQ86_09925) | 2046180..2046323 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
CLQ86_RS10050 (CLQ86_09930) | 2046428..2047396 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
CLQ86_RS10055 (CLQ86_09935) | 2047553..2048206 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
CLQ86_RS10060 (CLQ86_09940) | 2048203..2048394 | - | 192 | WP_002911395.1 | YebW family protein | - |
CLQ86_RS10065 (CLQ86_09945) | 2048492..2048731 | - | 240 | WP_002911393.1 | YebV family protein | - |
CLQ86_RS10070 (CLQ86_09950) | 2048847..2050280 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T145225 NZ_CP046962:2045703-2045805 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT145225 NZ_CP046962:c2045812-2045667 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT