Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2102279..2102421 | Replicon | chromosome |
Accession | NZ_CP046673 | ||
Organism | Citrobacter sp. 172116965 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2102314..2102417 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2102279..2102421 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
GPJ68_RS09925 | 2098726..2099388 | - | 663 | WP_016152773.1 | exodeoxyribonuclease X | - |
GPJ68_RS09930 | 2099412..2100068 | - | 657 | WP_016156222.1 | carbon-nitrogen hydrolase family protein | - |
GPJ68_RS09935 | 2100175..2100405 | - | 231 | WP_003034925.1 | DNA polymerase III subunit theta | - |
GPJ68_RS09940 | 2100549..2100923 | + | 375 | WP_016156223.1 | CopC domain-containing protein YobA | - |
GPJ68_RS09945 | 2100927..2101799 | + | 873 | WP_016156224.1 | copper homeostasis membrane protein CopD | - |
GPJ68_RS09950 | 2101820..2102158 | + | 339 | WP_003833793.1 | YebY family protein | - |
- | 2102279..2102421 | - | 143 | - | - | Antitoxin |
- | 2102314..2102417 | + | 104 | - | - | Toxin |
GPJ68_RS09955 | 2102495..2103580 | - | 1086 | WP_180837272.1 | phage integrase Arm DNA-binding domain-containing protein | - |
GPJ68_RS09960 | 2103549..2103821 | - | 273 | WP_032170291.1 | excisionase | - |
GPJ68_RS09965 | 2103885..2104127 | - | 243 | WP_001237028.1 | DUF4060 family protein | - |
GPJ68_RS09970 | 2104114..2104317 | - | 204 | WP_180837273.1 | hypothetical protein | - |
GPJ68_RS09975 | 2104310..2104654 | - | 345 | WP_180837274.1 | hypothetical protein | - |
GPJ68_RS09980 | 2104689..2105801 | - | 1113 | WP_180837275.1 | recombinase RecT | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2095056..2155293 | 60237 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T144701 NZ_CP046673:2102314-2102417 [Citrobacter sp. 172116965]
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 143 bp
>AT144701 NZ_CP046673:c2102421-2102279 [Citrobacter sp. 172116965]
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT