Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 68653..68773 | Replicon | chromosome |
Accession | NZ_CP045913 | ||
Organism | Serratia proteamaculans strain 336X |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 68661..68741 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 68653..68773 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
GHV41_RS00315 | 63768..64046 | + | 279 | WP_013813298.1 | hypothetical protein | - |
GHV41_RS00320 | 64097..66253 | + | 2157 | WP_153857124.1 | hypothetical protein | - |
GHV41_RS00325 | 66250..66750 | + | 501 | WP_153857125.1 | siphovirus Gp157 family protein | - |
GHV41_RS26590 | 66792..66968 | + | 177 | WP_013813301.1 | hypothetical protein | - |
GHV41_RS00330 | 67184..67525 | + | 342 | WP_153857126.1 | excisionase | - |
GHV41_RS00335 | 67500..68582 | + | 1083 | WP_153857127.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 68653..68773 | + | 121 | - | - | Antitoxin |
- | 68661..68741 | - | 81 | - | - | Toxin |
GHV41_RS00340 | 68899..69240 | - | 342 | WP_153857128.1 | YebY family protein | - |
GHV41_RS00345 | 69310..70191 | - | 882 | WP_153857129.1 | copper homeostasis membrane protein CopD | - |
GHV41_RS00350 | 70195..70578 | - | 384 | WP_012006367.1 | CopC domain-containing protein YobA | - |
GHV41_RS00355 | 70902..71420 | - | 519 | WP_012006366.1 | non-heme ferritin | - |
GHV41_RS00360 | 71796..72026 | + | 231 | WP_012006365.1 | DNA polymerase III subunit theta | - |
GHV41_RS00365 | 72059..73012 | - | 954 | WP_153857130.1 | prolyl aminopeptidase | - |
GHV41_RS00370 | 73185..73610 | - | 426 | WP_135316118.1 | RNA polymerase-binding protein DksA | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 52552..74716 | 22164 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 81 bp
>T142960 NZ_CP045913:c68741-68661 [Serratia proteamaculans]
AATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTATTCGGTCTTTTTT
T
AATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTATTCGGTCTTTTTT
T
Antitoxin
Download Length: 121 bp
>AT142960 NZ_CP045913:68653-68773 [Serratia proteamaculans]
AACAGCTTAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAA
GTTGGCATTTTGTGCAAAGCTTGTTCAGCCGTGCACTTTAA
AACAGCTTAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAA
GTTGGCATTTTGTGCAAAGCTTGTTCAGCCGTGCACTTTAA