Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1822086..1822231 | Replicon | chromosome |
Accession | NZ_CP043588 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015096 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1822122..1822224 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1822086..1822231 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CLR01_RS08855 | 1817216..1819276 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
CLR01_RS08860 | 1819280..1819939 | - | 660 | WP_021440386.1 | exodeoxyribonuclease X | - |
CLR01_RS08865 | 1820018..1820248 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
CLR01_RS08870 | 1820361..1820735 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
CLR01_RS08875 | 1820739..1821608 | + | 870 | WP_023282759.1 | copper homeostasis membrane protein CopD | - |
CLR01_RS08880 | 1821625..1821963 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1822086..1822231 | - | 146 | - | - | Antitoxin |
- | 1822122..1822224 | + | 103 | - | - | Toxin |
CLR01_RS08885 | 1822599..1822742 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
CLR01_RS08890 | 1822847..1823815 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
CLR01_RS08895 | 1823972..1824625 | + | 654 | WP_004175436.1 | protein-serine/threonine phosphatase | - |
CLR01_RS08900 | 1824622..1824813 | - | 192 | WP_002911395.1 | YebW family protein | - |
CLR01_RS08905 | 1824911..1825150 | - | 240 | WP_002911393.1 | YebV family protein | - |
CLR01_RS08910 | 1825266..1826699 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T139096 NZ_CP043588:1822122-1822224 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT139096 NZ_CP043588:c1822231-1822086 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT