Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1863055..1863200 | Replicon | chromosome |
Accession | NZ_CP043585 | ||
Organism | Klebsiella pneumoniae subsp. ozaenae strain SCKP020151 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1863091..1863193 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1863055..1863200 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CLQ49_RS08990 (CLQ49_09085) | 1858185..1860245 | + | 2061 | WP_004148850.1 | oligopeptidase B | - |
CLQ49_RS08995 (CLQ49_09090) | 1860249..1860908 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
CLQ49_RS09000 (CLQ49_09095) | 1860987..1861217 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
CLQ49_RS09005 (CLQ49_09100) | 1861330..1861704 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
CLQ49_RS09010 (CLQ49_09105) | 1861708..1862577 | + | 870 | WP_004891049.1 | copper homeostasis membrane protein CopD | - |
CLQ49_RS09015 (CLQ49_09110) | 1862594..1862932 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1863055..1863200 | - | 146 | - | - | Antitoxin |
- | 1863091..1863193 | + | 103 | - | - | Toxin |
CLQ49_RS09020 (CLQ49_09120) | 1863568..1863711 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
CLQ49_RS09025 (CLQ49_09125) | 1863816..1864784 | - | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
CLQ49_RS09030 (CLQ49_09130) | 1864941..1865594 | + | 654 | WP_004891053.1 | protein-serine/threonine phosphatase | - |
CLQ49_RS09035 (CLQ49_09135) | 1865591..1865782 | - | 192 | WP_002911395.1 | YebW family protein | - |
CLQ49_RS09040 (CLQ49_09140) | 1865880..1866119 | - | 240 | WP_002911393.1 | YebV family protein | - |
CLQ49_RS09045 (CLQ49_09145) | 1866235..1867668 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T139078 NZ_CP043585:1863091-1863193 [Klebsiella pneumoniae subsp. ozaenae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT139078 NZ_CP043585:c1863200-1863055 [Klebsiella pneumoniae subsp. ozaenae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT