Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2021623..2021768 | Replicon | chromosome |
Accession | NZ_CP043357 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WCHKP020120 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2021659..2021761 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2021623..2021768 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CLQ78_RS09875 (CLQ78_09875) | 2016753..2018813 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
CLQ78_RS09880 (CLQ78_09880) | 2018817..2019476 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
CLQ78_RS09885 (CLQ78_09885) | 2019555..2019785 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
CLQ78_RS09890 (CLQ78_09890) | 2019898..2020272 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
CLQ78_RS09895 (CLQ78_09895) | 2020276..2021145 | + | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
CLQ78_RS09900 (CLQ78_09900) | 2021162..2021500 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2021623..2021768 | - | 146 | - | - | Antitoxin |
- | 2021659..2021761 | + | 103 | - | - | Toxin |
CLQ78_RS09905 (CLQ78_09905) | 2022136..2022279 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
CLQ78_RS09910 (CLQ78_09910) | 2022384..2023352 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
CLQ78_RS09915 (CLQ78_09915) | 2023509..2024162 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
CLQ78_RS09920 (CLQ78_09920) | 2024159..2024350 | - | 192 | WP_002911395.1 | YebW family protein | - |
CLQ78_RS09925 (CLQ78_09925) | 2024448..2024687 | - | 240 | WP_002911393.1 | YebV family protein | - |
CLQ78_RS09930 (CLQ78_09930) | 2024803..2026236 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T138492 NZ_CP043357:2021659-2021761 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT138492 NZ_CP043357:c2021768-2021623 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT