Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2840365..2840510 | Replicon | chromosome |
| Accession | NZ_CP042578 | ||
| Organism | Enterobacter kobei strain C16 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2840372..2840475 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2840365..2840510 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| FR825_RS13885 | 2835761..2835913 | + | 153 | WP_047028424.1 | DUF1317 family protein | - |
| FR825_RS13890 | 2835910..2836392 | + | 483 | WP_047028423.1 | class I SAM-dependent methyltransferase | - |
| FR825_RS13895 | 2836389..2837048 | + | 660 | WP_047028422.1 | DNA methyltransferase | - |
| FR825_RS13900 | 2837167..2837385 | + | 219 | WP_006809800.1 | TraR/DksA family transcriptional regulator | - |
| FR825_RS13905 | 2837385..2837771 | + | 387 | WP_047028421.1 | DUF2591 family protein | - |
| FR825_RS13910 | 2837758..2838153 | + | 396 | WP_047028420.1 | hypothetical protein | - |
| FR825_RS13915 | 2838163..2838489 | + | 327 | WP_047028419.1 | DUF550 domain-containing protein | - |
| FR825_RS13920 | 2838968..2839240 | + | 273 | WP_023330710.1 | hypothetical protein | - |
| FR825_RS13925 | 2839209..2840294 | + | 1086 | WP_023330711.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| - | 2840365..2840510 | + | 146 | - | - | Antitoxin |
| - | 2840372..2840475 | - | 104 | - | - | Toxin |
| FR825_RS13930 | 2840614..2840952 | - | 339 | WP_014884299.1 | YebY family protein | - |
| FR825_RS13935 | 2840969..2841838 | - | 870 | WP_014884300.1 | copper homeostasis membrane protein CopD | - |
| FR825_RS13940 | 2841840..2842211 | - | 372 | WP_014884301.1 | CopC domain-containing protein YobA | - |
| FR825_RS13945 | 2842349..2842579 | + | 231 | WP_013096102.1 | DNA polymerase III subunit theta | - |
| FR825_RS13950 | 2842690..2843340 | + | 651 | WP_014884302.1 | carbon-nitrogen hydrolase family protein | - |
| FR825_RS13955 | 2843365..2844027 | + | 663 | WP_014884303.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | gtrA / gtrB | 2774678..2846820 | 72142 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T135936 NZ_CP042578:c2840475-2840372 [Enterobacter kobei]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT135936 NZ_CP042578:2840365-2840510 [Enterobacter kobei]
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
