Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2030839..2030979 | Replicon | chromosome |
Accession | NZ_CP042512 | ||
Organism | Serratia marcescens strain E28 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2030883..2030979 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2030839..2030979 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
FR888_RS09720 | 2026036..2026461 | + | 426 | WP_060434328.1 | RNA polymerase-binding protein DksA | - |
FR888_RS09725 | 2026656..2027609 | + | 954 | WP_038875880.1 | prolyl aminopeptidase | - |
FR888_RS09730 | 2027643..2027873 | - | 231 | WP_033638067.1 | DNA polymerase III subunit theta | - |
FR888_RS09735 | 2028218..2028736 | + | 519 | WP_038875847.1 | non-heme ferritin | - |
FR888_RS09740 | 2029030..2029446 | + | 417 | WP_047727770.1 | CopC domain-containing protein YobA | - |
FR888_RS09745 | 2029449..2030330 | + | 882 | WP_060434326.1 | copper homeostasis membrane protein CopD | - |
FR888_RS09750 | 2030400..2030741 | + | 342 | WP_025302452.1 | YebY family protein | - |
- | 2030839..2030979 | - | 141 | - | - | Antitoxin |
- | 2030883..2030979 | + | 97 | - | - | Toxin |
FR888_RS09755 | 2031400..2031729 | - | 330 | WP_038875697.1 | DUF1493 family protein | - |
FR888_RS09760 | 2031723..2032181 | - | 459 | WP_048233442.1 | hypothetical protein | - |
FR888_RS09765 | 2032585..2032845 | - | 261 | WP_192802313.1 | hypothetical protein | - |
FR888_RS09770 | 2033554..2033904 | + | 351 | WP_033638116.1 | DUF4377 domain-containing protein | - |
FR888_RS09775 | 2033955..2034257 | - | 303 | WP_038875692.1 | hypothetical protein | - |
FR888_RS09780 | 2034544..2035743 | + | 1200 | WP_047727768.1 | trans-2-enoyl-CoA reductase family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T135752 NZ_CP042512:2030883-2030979 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT135752 NZ_CP042512:c2030979-2030839 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG