Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2497823..2497916 | Replicon | chromosome |
Accession | NZ_CP042173 | ||
Organism | Yersinia sp. KBS0713 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2497824..2497916 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2497823..2497916 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
FFE93_RS11780 | 2492838..2493170 | + | 333 | WP_138775176.1 | hypothetical protein | - |
FFE93_RS11785 | 2493359..2493673 | + | 315 | WP_050941904.1 | hypothetical protein | - |
FFE93_RS11790 | 2493687..2495840 | + | 2154 | WP_138775177.1 | hypothetical protein | - |
FFE93_RS11795 | 2495837..2496349 | + | 513 | WP_138775178.1 | siphovirus Gp157 family protein | - |
FFE93_RS11800 | 2496422..2496688 | + | 267 | WP_050152217.1 | excisionase | - |
FFE93_RS11805 | 2496663..2497745 | + | 1083 | WP_138775179.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2497823..2497916 | + | 94 | - | - | Antitoxin |
- | 2497824..2497916 | - | 93 | - | - | Toxin |
FFE93_RS11810 | 2498090..2498431 | - | 342 | WP_005272472.1 | YebY family protein | - |
FFE93_RS11815 | 2498528..2499412 | - | 885 | WP_054872679.1 | copper homeostasis membrane protein CopD | - |
FFE93_RS11820 | 2499414..2499800 | - | 387 | WP_032814982.1 | CopC domain-containing protein YobA | - |
FFE93_RS11825 | 2500188..2500697 | - | 510 | WP_005272474.1 | non-heme ferritin | - |
FFE93_RS11830 | 2501088..2501318 | + | 231 | WP_049602860.1 | DNA polymerase III subunit theta | - |
FFE93_RS11835 | 2501372..2502328 | - | 957 | WP_032897036.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2449896..2501318 | 51422 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 93 bp
>T134938 NZ_CP042173:c2497916-2497824 [Yersinia sp. KBS0713]
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTTTTTTT
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTTTTTTT
Antitoxin
Download Length: 94 bp
>AT134938 NZ_CP042173:2497823-2497916 [Yersinia sp. KBS0713]
TAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAACGTAGGCTTA
TAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAACGTAGGCTTA