Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1865069..1865214 | Replicon | chromosome |
Accession | NZ_CP041092 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1865105..1865207 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1865069..1865214 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CI667_RS09090 | 1860199..1862259 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
CI667_RS09095 | 1862263..1862922 | - | 660 | WP_040224088.1 | exodeoxyribonuclease X | - |
CI667_RS09100 | 1863001..1863231 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
CI667_RS09105 | 1863344..1863718 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
CI667_RS09110 | 1863722..1864591 | + | 870 | WP_094487628.1 | copper homeostasis membrane protein CopD | - |
CI667_RS09115 | 1864608..1864946 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1865069..1865214 | - | 146 | - | - | Antitoxin |
- | 1865105..1865207 | + | 103 | - | - | Toxin |
CI667_RS09125 | 1865583..1865726 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
CI667_RS09130 | 1865831..1866799 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
CI667_RS09135 | 1866956..1867609 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
CI667_RS09140 | 1867606..1867797 | - | 192 | WP_002911395.1 | YebW family protein | - |
CI667_RS09145 | 1867895..1868134 | - | 240 | WP_002911393.1 | YebV family protein | - |
CI667_RS09150 | 1868250..1869683 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T127575 NZ_CP041092:1865105-1865207 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT127575 NZ_CP041092:c1865214-1865069 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT