Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3631702..3631847 | Replicon | chromosome |
Accession | NZ_CP040593 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3631738..3631840 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3631702..3631847 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
FFY44_RS17455 | 3626832..3628892 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
FFY44_RS17460 | 3628896..3629555 | - | 660 | WP_020324964.1 | exodeoxyribonuclease X | - |
FFY44_RS17465 | 3629634..3629864 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
FFY44_RS17470 | 3629977..3630351 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
FFY44_RS17475 | 3630355..3631224 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
FFY44_RS17480 | 3631241..3631579 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 3631702..3631847 | - | 146 | - | - | Antitoxin |
- | 3631738..3631840 | + | 103 | - | - | Toxin |
FFY44_RS29455 | 3632216..3632359 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
FFY44_RS17490 | 3632464..3633432 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
FFY44_RS17495 | 3633589..3634242 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
FFY44_RS17500 | 3634239..3634430 | - | 192 | WP_002911395.1 | YebW family protein | - |
FFY44_RS17505 | 3634528..3634767 | - | 240 | WP_002911393.1 | YebV family protein | - |
FFY44_RS17510 | 3634883..3636316 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T126119 NZ_CP040593:3631738-3631840 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT126119 NZ_CP040593:c3631847-3631702 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT